%PDF-1.3 % 1 0 obj <>]/Pages 3 0 R/Type/Catalog>> endobj 2 0 obj <>stream application/pdf product_sheet2014_WarmTec_140206_low Adobe Illustrator CS6 (Windows) 2014-02-10T09:38:14+02:00 2014-02-10T09:38:14+01:00 2014-02-10T09:38:14+01:00 184 256 JPEG /9j/4AAQSkZJRgABAgEBLAEsAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABABLAAAAAEA AQEsAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgBAAC4AwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A8qYqmVj5c12/sJ9QsrGW 4s7VZHuZo15LGkKq0jNToqh1qffFWoPLnmG49H6vpd3N9YVZLf04JW9RHYorJRTyBYEAjviqIt/J nm+5kjjg0O/keXh6YW2mNfVLLGR8PRijAH2PhiqhD5a8xT273MGl3c1vH6nOeOCR419Gnq1dVK/B UcvDFVX/AAj5qN5NZLo9695bGEXNulvK0kZuADCsiqpKmSvwg7nFWv8ACfmriG/Q19xKeoD9Wmpw ojcvs/ZpKhr/AJQ8Rirb+UfNUacpNHvUBYoA1vKCWVmRgAVr8LoynwIp1xVT/wAM+ZOVwv6JvOVo 4juh9XlrE5HILJ8Pwtx3ocVVx5K83myjvRot6bWY0ilFvIQ20bVUcalaTx/F0+IeOKqB8seZRcw2 p0m9FzcmQW8H1eXnIYSRKEXjVvTKkNTp3xVVj8neb5Coj0PUHLiqBbWY8hxD1FF3+Bg3y3xVy+Tf N7046HqDciAtLWc1LMVAHw92Rh8wcVWWvlXzPd2aXtppN5cWknqCOeKCR0b0SBIQVU7IWAY9sVVJ PJfnCMVfQ78CrA/6NLsUBZlb4diqqSQdwN8VWt5Q81KEMmkXkYkuYbKP1IJE5XNwpeGEcgKu6Dko 8MVavfKfmixfjeaTeQHmkQLwSBWeQlY1VqUbmUPGn2qbYq628peabmNZINHvZIniknSRbeUq0UVP UcNxoVWoBPiQO+KtyeUfNkZpJot+hFahrWYdG4HqvZ/h+e2Krl8l+cWNF0LUWNSKC0nO4kMRH2O0 gKf623XFULbaDrl0rvbaddTpFG00jRwyOFjQlXdiqmiqVIJ7UxVrVtC1nR5IotVsprGaZPUjhuEM b8eRWpRqMN1PUYqs0n/jq2f/ABnj/wCJjFUJiqf6R/jLTNOj1HR57m0s9VuG08SWc3AzTRKrGCRI 259J1oHFGrtWhoqnlt/ytnynrWqaVDcXNjfaRbJcapbGeKSFLWFUMRbkzwSJSZOAHINyAFTiqKuv Mv5223lay8zS6lqFv5eu2WxtbyKVY45DbGTgrpGVZgP3gVnX4qEVPHZVuw0H8200mz0+31mGzsb9 UvbTTpdf020dxeqsiSfV5buOUGUcW+Ja4qg9Rk/Nzy9YTa7eXV9ZWusXYtrq5W4FZbrSpCsaTqjl laF4m9PmB9k8agHFUTow/OR9Lt/MNlq1zY6bqvLSYNSudUgsIpVgjqYudzPCOIWKgY7EjiCW2xVE 3ukfnVZSWNodXaS4uCv6OsLLW7K5mZbz98rxW9rdSSenJy58gvGm9aYqsktvz107UlZrjVIL/wAw XsSVF18VzeFWSPnRyCeBYVbYDrtiqjHa/m3odheXVjryGC2iMl5Hpmu2F5KsIMYZzBaXU0vFTHHy YLtQVxVj8H5jeeYb6xvl1u6e60wTjT3lf1RCLkkzemsnJV5k1O36hiqhd+efOd56f1rXL6b0Y1hi DXEhCxoUKoBXoDCn/AjwxVXf8x/P8noep5j1F/q39xyupTxq/qGlW/nAbFVPTPP3nbSrVLXTddvr K3jSWJIoLiSNQk7B5VAUjZ3HI++Ksn8uP+efnSJrPQ21bVInvPr0lzGWCi6r9t7tuIUg7gGSg60x V6Uf+cdv+ck9ejjn1fXoopY54ryNL7UZpJFuIU9OKUNCk4DogoDyxVu4/wCcV/z7uPqnr+ZNPk+o CMWdb28/deiQY+H+j7cCNvDFUUv/ADjX/wA5FrK0q+bLJZGVl5C/vRRXbkwWlv8ADU+GKrz/AM45 /wDOShvp7/8AxlbfXbmguJxqV+HkAqAHPobgcjQHFV1x/wA46/8AOStzDcwT+cbWSG82uo21G+4y fvDN8Q+r7/vGLfM4qhrD/nGP/nIbT7U2th5qsbW3KSxGOG/vUHC4NZV+G3GzncjxxVA6v/ziN+de s6jNqera3pV9qFyQZ7qe7u5JHKqFHJmtqmiqAMVUbH/nDT81IL23nfUNGKRSI7AXFzWisCaf6Nir 58xVnH5cee9L8tw30eq20t2I3i1TQxEEYRavZrItq8gkI/c/vmMlKk8V28FURfef9G1HyZZaTdJd prk5trHX9UVUkEmmWU0ksIjDSKXl/eoGDcR+5j36nFU/vfzY/L6+bU9Nk0PV4NAvtPj0m3h+v2s0 VtDZnnZzxWn1SA+rHLWQ1udy71YhjiqTXP5tzJqOhNY2dk+n6XZabazm80jSrm6ZrOCOOYrPNDNM QWQ8KyAgU+ziqLufzO8t3t2NOvYL6bytfi+j1iH92bqk+oT3tpcQM7upng9Ybu2/xrWjVxVJ/Nf5 g2uu+XbnSktpLWNNRt5dItFoYbbTrW2lgig5cuRk/eBmPH4mLMdziqvpvn3RYfzB8s+YJY51sNIs dPs7senHJJztLJbaRkjL8XXmtQGIqOo7Yqm8/nzyfZ6roupW9yl8thfJNc21p5d07RZTAUdJCtxb TSMxAb4Y2HEnckUxVirH8uLCzvpNP1TWr++mt5ILW3msYLCIPJQcpZor+7ZlVa/B6dGPWgxViWKo iw07UNQuVtbC2lvLl/sQQI0sh7bKgJOKvX/JH/OKP5peYmjm1K3Ty7p7UJmvzWYqf5bdKvX2fhir 6J8h/wDOKv5X+WPSudQt28xamlCZ9QoYAw/ktV/d09pOfzxV7DBbwW8KQW8awwxgLHFGoVVUdAqi gAxVfirsVdirsVdirsVdirsVSX/BPkz/AKsGnf8ASJB/zRirv8E+TP8Aqwad/wBIkH/NGKu/wT5M /wCrBp3/AEiQf80Yq7/BPkz/AKsGnf8ASJB/zRirv8E+TP8Aqwad/wBIkH/NGKu/wT5M/wCrBp3/ AEiQf80Yq7/BPkz/AKsGnf8ASJB/zRirv8E+TP8Aqwad/wBIkH/NGKu/wT5M/wCrBp3/AEiQf80Y q7/BPkz/AKsGnf8ASJB/zRirv8E+TP8Aqwad/wBIkH/NGKo/T9I0rTkZNPsoLNG+0tvEkQPzCAYq i8VdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVYF5g/O/y BpE720V22r3kZpLbaaEnZRxDcuTMkZG4Hwsfi265XLKA2jDIpx5O/Mbyd5wjkOg6glxcQKpubNgY 54qqrfFGwBIHMAstVr3yUZAsZQIZLkmDsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdi rsVeU/8AOR/m6fQvIi2NnMYb3W5xacl5BxbhS0zKy9P2VYUNQxFN6irLKhTbhG9pNon5d/lrJo/o fo60nFgAJ2kdHkQ0NfUYtyWu5NdjmvEiRbtjjiNmFeSrbTfLP58aTLp1yYNJ1H1bIxIXfl6sLGOB gnI8fX9NxyFB1J2y/Tz73E1WOuT6kzOde7FXYq7FXYq7FXl/5zata2MtgZfPE3k0JDPJM0dvJcJM oKlK8PslSjUpu1aeGKsJ1jzJaXOpa5pKfm5NZ3lnLeXEllHZXSz2yaVBdRyxqwcNKEWNZJAK8zGW A+LFVLTPNuh6p+kp0/N66ubSK0uZfq4s7u3ktFN0j+tKVaOT93xZAH/YIpt1VVH1e1s7e51yT82W l0W71B1slkjv2SEOOUcRaKZJP3aTIfiPAgEtspoqnvnH8x9C1ew017L8xIfL98n1l5BYW81zHcxi UpEeDAN8EkAVj7uu3IYqx/X/ADfpa3d5bTfm9LYwuyusSWV2HiWC3dYIlnVl5PKs0csi9ZGWoG+K qc3mzRFudYtLz85phLC17bxW4tbiB7e5lcMlCrB5fRIUKo60dR3AVai8zaTLLf6hB+bxbSru8D2M Nyl+iQRMJxHCZlmhZitV35UYp8WKslvfMmn+dfNDaf5U/MuS0uryRZbbR0t5VRkhs29RY5Kwy0LA u/BwFIoRy3xV6l5R0jVtI0OKx1XUm1W8SSZzdsHrwklaSOMGR5ZGESMEBdyTTFU4xV49+bv5s+aL DVX8o+Q7NrjXolR9U1F41aO0SVecaRrIQjysp5cmqqjajEnjVkyiPNvw4ZT5C2HeQPzw/NDR/Ndn on5kWqXOlanMsEWsrFHbmCWXiqcmT04WjDfa+GoqW5fDxIx5oy5FOXBKHMU+ksucdiP5peUI/NHl Vrb02mu7GZL+wiVuIa4hDBQ9FclaOdgK5XlBMdm7ARxi3nl5c6Na6RHa6bY3E8s9q8iW1vE8rcAw oFB24owWi1oNhQCmasi9neCQiLSJrPRfNnm3yXb6NHDZwq0d5AHZom9GIhpRbyQMHRzbQt6Tr4KQ QN8uwgmTiaox4LfR2bJ1DsVdirsVdirsVeW/nF5m81aRf6Zb6DJfo9wjPIbPRTq8YSM/vA5V0dWY snEL/LuVqGCrBLnz7+ZtnNDKt7rc0AlIv5pPKQQLHFzM8jP6qniU404qa0A2NcVUH86+eEvpI2vt TZ7iyiWw1NPJ6SUS59K5kYNHPV0Vf3brxADMp3pyxVWvPNHnm0iki0+bVdNt47e1mQ23k9GFfR5+ ixEjKCkpd5EKjiXopBqMVZ/Z+V/zfuYJZR5ysIoJoo3spP0PGkvqM8cjGWNn+AU5oFqx3qTXbFUR qXk382LjUbqa187WFvayySfV4G0WCQxROzBEZml5SMq8VrVfs7g4qo6t5G/OC4JFn59s7SrSMjHR bd3pIXAWrSU25rU0+JgD4gqoj/BX5nCQTN5zsjSFVo+jwER3ItzE08Z9RSOUrM7Ka7HiCN6qp75T 0Hznp99cy+YdcttXtmUCzigsUs2iIZiSzK8nP4SANh9PXFWUYq7FXjr6Vd2fn/Xb++iNyLy7EnMU QCJIYkiUKzGvFAB1qxqQOw1ucXk36O60pEce3Viv5rCz1e2ubKxhIniEjyyPG4SqEheLBeLUfrv7 b5CIAlYbM1mHCX0TAJxBGJ2V5woErxqURnp8RVSzlQT0BY/PNq6F5N/zkf5sstP8hXmm2vmBNO1i eSJX0+Fla6nt5KiSMqDzij4/Gz0oQvD9vEsgCN3g35efmC0F7b6ZcS3eoNcUjhtoX9NzNxNGEhMX IFtuDvXseWzHAzYCLLsdPqOQYp+ZE2qXsySX5NoTdFo4Sx+BEBFK1Iap4nwG9K4dPV7dzXqSa373 2D+Qtw035TeXxJeLezRQsjuJluCg9RmjiZlZ+JjiZF4HdRRSARTM0OCWf4UOxV2KuxV2KvF/z+e1 TVdCjmTSzLeRXEdu2oXuoWUvNGjCiJrHcgtKFP7VWHzCryrULzyzqFhea9AdFM0cv1vUhb6r5ggX 05R6qhIViUcneFwwVeSFQASwGKob9HeSrtrWa2l8uNMxkh05v0v5gkrPAYzLEjgJwUQcGqOrUFaV xVXu9V8rszXlhP5alS7s7j6qLjUfMEBmWfnDNyQ8R/vW1wI2dunDjw+FsVUrWPyfqGkRadat5dQy 3NpDZ2iaj5hWAiEScWWelC6G6UFQKKTV3qQAqhBd+UbdZtNt7jy6qXnqTJcrf+YLmG3MFsYW9VnZ DXjey04UO9TSmyqZyWnljVrW1uIBoFzNcGPS4rn9JeZDCLlIkMEMZRVUH0vTqwpVvh41amKpVFe+ Ubj9INIPLqrHGY7gXGpeYGilCKLeQkUZhGvrSKsr1ZpAOI3BxV6h+Vn5ueXfLslzoOuavolhp0Al kgtdPk1S8mS4Mn79JpbuP4eLB6IP2dxspYqvfba4hubeK5gbnBMiyROOjI4qp38QcVYx+ZvnS68l +VpPMMNidRjtpY0uLYMIxwlbgGaYk+mAzDf03r0oK8lCRTyvyv8Amynn3ULqVI10S+cRiCxlf1PV iUFGb1OMPMFg9OJH2aHYHMHUA8Vu40M48NJX5p/N2H8v9ZtfrELaxqrXMsyaWkiR0ieNgWklEdEP 72qrxJNB45HTwJlfQMtdliI8APNhPnP8+vzH80TsLW+fy9pgPOG001+ExXcqZbkfvC/FqMBxTYfD XNiBbpS86FlbftKHYmpd/iNTTueWGkWraFb3i63aiwtGutQmdI9OjjeNZPrXIG14tMjqtLhY6nqR VagHYSjYZRNGwv8AP+o23mbXJNQtoXsbYKIoy7s8kvxMzSyISyRszMfgj+FRT7TVdoY8XCKZZcnH Kyp+V9Y1/wAr3P1rQNSn069HGk0TU5emQypIhqkkZKjkjAg9xk+Fhb3n8uP+cobmKWPTPPyCQNxW LW7aIJ8bybmeFSFCqjdUFfh+yxOwWn0bb3EFzBHcW8izW8yrJDNGwZHRhVWVhUEEGoIwoX4q7FXY qxXzt5e866tNZSeWvMcWgi3WYXAlsIr4ymReKUMrLw4H4tuppWo2xVG+WdG12xguU13UbfVpZWjM U0VolpxVYVV1ZVZww9QOy13ANKmlcVTkW9uKUiQUrT4R+0an78VcbW2IoYkIpxoVHTfb5bnFWns7 R6c4I2oyyCqqfjQgq3TqpUUOKtR2VnEipFBGiJQIqooCgLxFABtRdvliq9YIFpxjUUNRRQN6Ur9w xVoW1uDURICNgeI6bf0xVZPYWFxFJFcW0U0UyGKaORFZXjYEMjAihUg7g4qxTz9+a3kvyFBCmsTO 15NGZLTS7SP1J3jRlQsBVI0UctjI6g0IWpFMVfN/5lf85HeYPOuhXeg2ejW2naRdpGLkSu1zclop RMpVwIkRWMainpsevxbiiEvO/Kep2+h6vDfswiSJ0aZH9R/ViZgjxqEDKdm51fpwr4Awy4+KJDZg ycMgV3nvzHbahfXlnoLMuiRzevGXj9ESOF4iaQ8QzDdzGrfY5NspZ8GLHwx35pzT4pbclHSLzTL2 4ma9aTT4ijukdvGJ6P8AsoBJLH8G/XkWA7HLLa+qbWUHlNrOOS71K+hvGCG4hhsYZolNfjCyteQs 4CbrVFqdtuuFipWNhp2oeYdK0y0a6uYL2eCCZhHDbzepNIEKRVmkWtCOLuyivUDFSo+X59IttTH6 WEn1YwyxqqWyXfIunp0dGuLQpRXYh1k5KwBHiEpBpOrTzFpWkaai2DRH1xNc3y3ujafdfVpmiUpD bzXUtzJJAGTjVinEVfizGmClJth99eiS5aUyRu87IZGiT0oqz0Z1VFWNV48ylEXjX7Pw4oD6b/5x p/NJtRtm8kavOZNQsUMulzO60a2UD/RlBCtWJTyUfF8FRsEwMiHvWFi7FXYqwb8y/OOseXH006fd afbpOztcrqEd0wMaFalJIFZEpy+Llv4dMVecW3/OQurG9kafXPKI09eANJdSSeOhHrH0zC3qFK0p 8PTl+1RVVth/zkJr8y6i8ur+VZPqVrdXSJbjVmP7sq8YasFeKxtR2UVLVHEcGGKocf8AOQfnCJBe 3WseThpMjMi3KHVuStCVknjA9Fg0qxSAKh4kn4uh44qiYf8AnInV/wBIMt1qvlWKxeGWSBueqerz Tn6asptwKseCMuxU16n4cVZn5f1z87tYW01OBPK8+hXDI6SwS35eSA15lC0aitfhUkAHrTsVVSH/ AKGH/SEwkPlr6iIpRAaXYkM3pn0S4BI4c6c6b+G2Kpr5fn/OM6tGuvWuhLpHOkslpLdfWQgjC/Cj q0Z5S1bdvsUFOVaKs1xV8DfmD5mvvMHnXWdWvoHtdSmuALjT5AS9r6Y9GOJjwj3jVAjnjXb4twcY sig7bSpJImvEltI43RJCsl3axvRuRAMbyK/L92arSoqK/aWpQAhlN7ZvY3dpcG2lLH6pNCxWeOSJ uSN8B9SIqUJBIBP2hiVVrTSJr+3k+DgLz1orW4naOG2MlugeZTNO0aFlQj4OVSXXforKilLUtM+o c7CYRC5hcF7m3lhnioo/ZaNpEY8qEMHK9dsCVLTbn6xCCQAEKoeVAeh+kj4T09u5xClM9Jnitdb0 +7lhWeOG4hkkgkQSq4jkDFWiLIHBGxXkK+IyTGkA4oBvuRQjxJIwJc7gLuQF3J6GlP8AawKx/R5J 53idqMyN+95HoqAhSASP2iOmIKllXlvzVe+Wdfs9Z0+QNd2lxFLGAWoeAZRE3AqSJQ7K4qKg0wFI ffthcvdWNvdPC9s88SStbyikkZdQxRx2Za0OFBFFXxQ7FXnv5uFI4dMuXi1+UW86SCPQm+FiJYwB MhZeRFea+wb5FV5XBf6VZRkCb8y7hURI2mlsh6jIY9om5xRlilAa+LVryc1VTX9LafYW+lX93D5/ vL301Sc29nOEkFvKQZp7cl1i9T6tQp9oq243JCqXXH1m1067ludS/MCGwtPqlyPVtIS8VtPEJJl5 VIkVFn4yNxrGU6njiqrZXWnXOmWTasv5hXfJlvDHc2IdphCpU20kKK6hH3KhtzyBDcqHFWY+UvJt 9ffpKztvNHm+xism+qo2oLBAjxyWtFezAhVeKNICDxqGWlO+Ksz8o+Sbjy3cTPL5k1XWoZFb04dV nWf0+b82IYKhIGwWu43FaUAVZTUVp38MVdir8776e81W81DV7yrandXM095JwFXadubtwFAFJepA UD8KAMi3Z2moz2Mt/wDVJjYQSelLeKhaESBVPH1QOINHXZt9x44eIXSiJq6RehnT5dRMd/KkcRs7 xoi4Yg3CWkpgQCo+J5gir/lEdemFCEiSVlb0UMhRmWSnQNyAoT41IxWi5rZmfj68ZdObMn7wcVQK RJyCkEPyIWndSG4giotlSE02fnI8XAhljV1k6KW5MDxHSjK37VTUde2RHNTyTQMySJIgKyK6upIr uN+2TYqU0ZVgj1LKaE99jv0xVSmDLGa1UUO1e/scBVN/N2j+X7Typ5LNpDcW+sX1hcXGqSVBtnja /mjh+Ff3nqDg3IgqoAXuTkQljcMFr6rO9wHeJ+a7Ban/ACjy+I0HZaUr3xKQ/Q7QLk3WhabdNdC9 ae1hlN6qekJi8at6ojIXhzry402yTE80fih2KvKfz0dBbWy3Frpk2mtbTDUp9RGoF44DPbikQsUP Lm/FChZS9Qo2LAqvCjf+Q7HUFuIk0JLO7aK2lka/8yKfrTaeiXZUCLhT/SOKSV5ce9a0VTHVl8vW OkXV9Zy6DFd6o6xrdSanrhiexadpbd1uG+x/pUMnJUK1VfhZT1VUriLQrTRF1G1g0O4tHWWC/dNS 8xlREYzNxCcS1BaTLJ6lKmrMq1NGVbt7by212i3U/lx49QgjTTrNtW1wCa9F+ih2EiPIrI8TIXqa 8Ry2OKp5pWgjzTqaaf5Yj0e7vrO1ihu1m1LzHEhgFitrMbfn6ccnKX1YhKAxVRUgtWirK/L/AOSW p32vahF5w8u6emkahFIb67stX1WSSWWeWOdlijlk+BOUQR/s8gPDYKvUPKf5b+VfKl1PdaNHdRzX C8JPXvbu5Xjy5bJPLIgNf2qV98VZPir4J86LHpnn/wAz2ttbrbW0Or3i26RMYYzGLpgITGtE4LHX jUcR074AyZd+W/5raR5S0f8AQmr6GtzbNPJdGezkJmYSFUHKNvhlZaFeXNfhUCm1TRkwiRty8OpM BTzDTL6C+SaRljkdzxbiDEAa8iQkfBAGoPh3XL4jZxDLe0ZarbRyfvIBOnFlkQOyepzFKtSjV36j f5H4sNLai6SLerc2tYaMHZxI3MEU5fFSrFuJ5V8cFJtbaosfqyM9WkPxE7klQOTfee23sMIDEoiZ mBiFKVam3sDhQG5iB9pqgftE0rTuTilDiKfUZlsLeNp7q6lS3hij5F3kkICooXcseQ40yJUM6/OT WvLms+b7TS/L063OjeV7G00OC+qZ0l9AuOZCRgMoYlOQPH4eQNGGBIQv5PflZdefvNDWT3DW2jaV WW/nSII6oXISOJo1CLK5qRyNBRmo1KFCSX23Y2VrYWNvY2iena2sSQW8dS3GONQqLViWNAO5yTBX xV2KsC/M+PzK5tv0NZ6pKogn9S50y7ggCOePFGim5c3b9h+BCbk0xV53p/l78z5bbVzcWnmWKSYN 9ViTVtKkIaOW2NIS8YSsimSnM8QikcQaVVQepeR/zE1CC4u5dL81WlxLdKxs4dd02RV582ZoJ5I/ VSKNlQKBxNTyChh8Sq+40T80DLdGfR/NkfrJcRWcEOuaf6LO2nvGjVghLQ0kB4uwChihNTRVVc/l T817exhigtvNZuruZzdXB1zTSYhyjjp8ULKU4c5V4KDyqNi2yr0vRfyuu7JtMlbzXrLiwEYltxJF Ek6KifuplRDQclY/uypo1K9yqh7r8pNWmBkt/wAwfMkdwEkCMbmFouTr8JaNIo6hDxNAwrTrvXFW 2/KDUmgMf/KwPNKu/wDfyreQhmJDglQYSsezgfAAPhB+1UlV6BY2xtbK3tTK85gjSIzSnlI/BQvJ z3ZqVOKvAPzc/wCcfvMeseaNS8yeW/qssV76cz6apFvP69FjkKFgIW5FfVZmdSSW6nqpfP2tJcaF qF9pGpsLa7tp2jvbZ3Uj1kO9aEq24rXcHriu6WQwtcpJDp7GeR0eUiMetN6cf76V+S1kosUbFj2A J98aW0MmozQqsskExFKFg5FRsR8Ow7/yj5Yot6D+Wnk6DzjbzXc996KW84hlsUC+rw48vUZz9lT+ yeJrvmPmzGJoBzdLphk3J2b82+QbrR4mv7N/r+kRStFMwVknspA4UJcRsAyq3MFJCAHrUbMoMsWX i2PNjqNMYbjcMStjPJOgckkEMsaq1f5abFq7+GX04ilczFxu3EBa+mqksWA+zy6U6dhgSzr8u/IW qrqtlqMuow291DCtylogM01uskfqwtd8FMds0kZBhIkWWp5IVZCRi5M1cnOw6Pi+o/jzYx5h8k3H l/XrbQ9LuWv5r6OJrbjEwleWRiiwmNuVXDclUAn9kji1VFmPIJi2nNhOOVF9k/lB+X1t5J8mWlg0 KJq9yiz6vMAObTtv6ZZWcFYQ3prxPHYsB8Ry0BxyWbYUOxV2KvKPz2vNDW0t7C/l0gT3sEiJa6sb tDNClxbyzIkltXivCI8vhLHttyGKvELPzB5P1WGzs/r3l/TtMeS45Q29zrnr8J5Ymmk9Vo6xuOMZ jjI+MmlU+JcVROpXvl554YmuvLC6XestxOW1PXvVKRzyqswKilVdpgSe5VWoF+JVf5e1vyusGp2F zqflo2DG4n0+S31LzAZla4lh5rLPIeSAizjZpA3wnt8eKqN0vl/66q3c3lmLTrW3jWRU1PzApRLk pKZAV4gqwuEQy8f2qNt8IVQOrXflsfWbCQ6BBbhnlUy6n5hhR1uIYmUuxjWSZ5rdo6nmw/yepxVl HlLWtO8keabFNGv/AC3asq3C+Y4fruu3LLFCpkkWMS+pEDFDaD42H8u268lXsXl/87fI9xYWEWra 3YprFwsKzrZi4ktWmmkaFVhleNeQ9SMrv0PXFXomKsU/NXX59A/LzXdUt+QuIrYxQOjmN0kuGECS Kw3BjaQN9HbFXw1cW+mySE21uyKURGWX02fmEHqEMipRWerIDuFIBJNThVMdBs7U3kivaveILO8c RRSmIhktZXSbkzR1WFx6jLX4gvGjV4lSEseFH+0Aw+yQdx1r3r4YoTHylrUmg+Yra7tjJbq6tBdt b8TK6SbMY0aikqOLIrkjmN9tsryQ4hTdgy8ErZ9+YfnbTL7RH0xDfTalI0L+tE5trF4GRZVrHKBP LGzUlWOVSUdjwkZKA14sZi5Gp1AmK5/j8fjnBfLsssfmXSvgS5lS7tWjt5YxMrt6o+F4TJCJAxAB Qute7Drl5cFK5RGqgKPTkFQr0HgPfpiVepWHn/yTpXk+1sNO02QQ6fLBJ9Vk9Myz3Rglb1fUV0Le nLGrGYxHj8ISNDxZcOeGRLtMerhGNAft/H4D6O/LaDynqflnSvM2lWEST3sHqG4cepPHIwEc8XrM iNRXjKHiFU0rTMmEBEbOBlyymbLMcm1OxV2KuxV5z+bvlbzFrSWT6Ib+KaLaS507UIrCREEqMyH1 I5OYdQTQmhKgHrXFWD6DbfmbpPmSDWLzQfMklkhijNndappl1ATKxidniih9U0Dh2YHsSaKikqst vvOP5gx+bI7Cb8tPrWjfWzaWespd27MIvUqlw0PBmijDRqxqfBhvQYqq6z5y/NG1jgfS/wAtfroc yiaI6jaxugjYemfs8TzBLAA9qdTiq7/Gfn+5isZYPy7ZbW+WM3yXN1Ek0EbGRKyQ+kefwxr8CsXA YclHTFVOTzf58tWNvbfle/6PggURcL2zXkxWNY4UiVfhANVYtRVCV6UxVbP5/wDzNFfT/Ky4mPJV m/3I2S7Ors1OQHOgKg9qsw/Z3VTmLzL51/TtvZT+RHGmy/Uz+lI720dYDKqmf1Im4P8A6MzMP3fL lxqKVGKs3xV5X/zknqVzbflwLGARk6xf21ixk2oKtcCjEqqnlbj4m2Arir5Fufq5nkktYzbxc29F GbmyISSqFqIHoNvsj6MKV8TqrI7UVyrqamlGZCux9+WAqEPIjlQiDiNhtQUA7DChatswYXHwejEy gjmnPkQSKRsebA8PiYLRdgSKrgIZBFLCyqI1ZloOLCvI7U6ljXt1woRmg3NrpfmTRtRdgsVnfWks jP6pVVinVzy9NZXpxG/FGPgCdsBVBnmF9Qn4XoSKb+wIqThQvtrmW3eWFZ5IYLoCG9WNefKHmrkG MlEcBkDBSw+JQag74EvrD/nGS+vLr8sI1nctDb3txDaIeNUiojstVAJ/eu5+Kp38KDEKQ9YxQ7FX Yq7FXnX5v2/5T3FtaJ+YTstpEkk0Q53SRFEkiLeqLchXHPhQOD7d8VYPqy/84wxNYX+oX0xttbL/ AFa6NxqjW8jWgSNxIytxHGg+3tUE/arirJfK/wCVn5K+atOtvNGhRXF7ZXM73Ftd/XNQRS8U7lwI 5ZEovrcyVK0P3Yq9M0XSLLRtJtNKsQ4s7KJYLcSyPK4RBRQXkLO1B4nFUZirsVdirsVdir5i/wCc tdVuZfMWiaRRRBa2bXiMuzmS4lMZDE1FB9WXjt41ril4WvGhYlg3dQWqK9NlOFCyWf0SKOee6/vF SQEHbo4IBodj1HUEEDFLRMqOVZTI5oaBiWpXbZqU+7FVOYKyfEWWtajcnbfseIwEKEaC7QhkelQC 2w7/ADr+BxClLr6fi8bIRKykFADy3H7PEe52xJUIm0llkStAXX7SdK1+n54ULpmmYkIPhFdq0Py7 fD8jgS+n/wDnEyfUj5P1e3lj/wBxsN8GtZjuTM8Y9dBvsqqsbAcf2juewCl7nhQ7FXYq7FWM+dPJ H+JzZuus6ho8tkJ1R9PlEfP10C1cMGBMZUOh7N7VBVSeX8pRP5ch0W48065K8EskqakLlI7k+pGI xEzRxoGiUqHCEfa61G2Kqsv5a6g0omi81apbOLyDURHAypCZoIlQxNHvW2kZAzwgjuOWKr7H8utV 08XwtfN+rSm8njukN68dyYHiNVjiqqAQEbNGa18a4q0/5aXbWt9Zf4t1sWl9dm+r9YH1iByFAht5 +PJLcBT+6oRv86qrbn8sbq50m002TzXrKGxjmigvobj07p1lkjkBnkAIlZPSoG4jYkYqzeJXSJFd zI6qA0hABYgbsQKDf2xVdirsVfHf/OSOo3d1+bN/bTPyjsYLaC2FFXjE0KzkVABYepM5+Lx69gQk 8nmEhdqqG4gVLMNqLQVHz9+2KGYfk/8Al5D5783yaTMyQ2cVhdXE0jFy4bh6FvKoRlLtHPNG/EsA Qpr4EJYpNbXtndTWtzGyTW7tFcxSKVkSSM8WVkajA8l3B3+nCqhOQyEUBJNVNaqe9ev68VXRt/os T8gFILd/hoSu5PjgCsz/ACQ0a31r82vLttMG9G2na+5xUDB7RGuY6sQ3wmWNQ3tttgKpf+YGgL5a /MTXNIEP1W3gu5DawhufG2mb1IBXkzN+5dT15eO+EKx+SZudEQs42oagA03/AMzir6g/5xQtEXyh rF6YlE02oehJOJGJYQwo6p6ZAVVX1yQwJLcjXYLgUvcMKHYq7FXYq8r/ADi8vaJquraNJfjSmeFJ UuF1HVbjS5vqcgP1ho/QYeoAgP2htU7juq878weS/J/1aWLSk8otYzJ8b3nmK8TjdgzVClXYD927 mooeoOwqFXoF1+W/5EanLAhvLVrn6msdsYNT4P8AVoEaQSRiOUbIvJ+YGw3xVmfk7WvJQ02y0PQf MFrq/wBRhjhj43sN3cMqJ8LOUYliVUmtMVZLirsVdirsVdir4/8A+cntPOnfmjNcev6n6Usra7EQ XiYyoa14dTzr9W5V96U2qUK8lkILKK8GbqK86HtUeIr9GFL6t/5xT8rnTvJF7rsqOk2uXNIyzKQ1 vaco0biN1PqvKDy8B8yEPH/+cgvL50H80tTkjtvSs9WCX9uAeXMzClw/ViC06yHifo2piEvNbkVL MKNHWvE8h0PufHxwoU7ZpPQrWhRjTrTftsRgCXun/OI+m3Mnm/WtUjjrZ29h9VllqBSSeeN4141r 8SwP27b4FKWf85PaObL8zTexuWbUrOC6ICgFTHytuIO/LaAH6aYQryZnlKmpYkk8jQEb9jStcK0+ jv8AnEG7nfTvM1o0h+rwS2kkdvyJCNKswZuNeILiNdx1pv0GRUvoXCh2KuxV2KsM8/fl+3mm90u4 A0tlsHImj1PTY9Q5wyU9WONnZGj5hQDQ/QcVYn5k/JDV75TFo135f0y3mRFuo28v20xkZJHatWel GVytCD1YggnFXocfkXyZHdxXiaJZC8hha2iuvQj9ZYXQxtGJKcuJRiCK4qhdN/LL8v8AS9Vs9W0z QLKx1Gw5/VLm2iELJ6kZhf7HENWM8firtTwGKsmxV2KuxV2KuxV8O/njqqat+bnmK7t/UEMFwtkI 3Arzs40t5aKGIoZIiVrvTsNxhCWFWlrcX2oQ2drA73F1IkUUSKZJJGc0VVAqzFi1FH0YFD9C9H0f TNG0u10rS7dbXT7OMRW0CVoqr7mpJPUsTUnc74oeMf8AOWPl+W78paVrkKu7aVdNDNxUsqRXagGR 26KBJCib92xCvlhwzxsQByNKgGnTrWmFKHjjKQFYjyo9CviCKilKHahwK+pf+cQdFaDytrusGUkX 15HarCVoFFpFy5Bq7hvrPGnEU49TXZQhv+cuNPJtfLeopCvwPc28s4KB/jEbxoV+2y/C/sv+y3U9 HzixlYlYeKpv8PQ7+O2FXtX/ADiaYv8AHerAMS7aW7AEg7evADuPoyK3s+qsKHYq7FXYq7FXYq7F XYq7FXYq7FXYqsnngt4JLi4kWGCFWkllkYKiIoqzMxoAABUk4q/PXX9ZutX1/UtUnEa3mo3U13NH b14AyyGRlG7fDVtqn6cKl6P/AM40eVptZ/Mq21J7blY6JE93PJKgaP1XUxwLsrIsgdvUTcH4Kjpg KX2NihJ/OPliz80eWNS0C8PGHUITGJKE+nIKNFJQMnL05FVuNd6UO2Kvz/vbe8s7iezu4Gt7uEvF cQOvB1kjJRkYVryBqKFdqYUoWOFuZMgYKwrw+Erv+x8NOlcCvrb/AJxNvYZfy+1C0EiG4ttTkLxB gXEckEPB2XqoYqwXahoffFSs/wCcsdOtZvI+lX7Rhru21JYYpKsKRzwyNItAafE0KdfDFXyqjq70 QjkRTlvuenfw9jhV7T/ziasifmLqaMfhOkSnj4UubcDrgV9YYodirsVdirsVdirsVdirsVdirsVd irEPze1a20r8sfMt3chzG9hLaj0wCwe7H1aM7kbB5RX2xV8KCVDFVz8XQr0P3eJphS+m/wDnETSZ 4tA8wau7IYry6gtUUE8w1rG0jFgegpdLTfx+kKXv+KHYq+HPzo0V9J/M/wAyQS8ZGnu3u4ytR8N7 xuANwOnqCvXcHEJYPUrMPSHqV2psSvMUUYVfVf8Azid5faz8lajrMglEmq3nCPl/dNDarxWSOoBN ZJJFY1I+H2NQrN/zq8oy+afy61OxtovW1C3C3livx8vVgNWVFjBLO8RdFWh3I+YVD4fL8W48vjbY 1pQ7j2FcKvR/+cbpKfm/o4fjzaO6qeW5rayt7cjt92BX2lih2KuxV2KuxV2KuxV2KuxV2KuxV2Kv H/8AnKTzAdO/LUadG0Rm1m8ht2jdgJPRhJuHeNag/C8UasaEDl7jFL47ieaQbAJQ/FyLA1p1BKjC r7y/J3yxqvlf8ttF0XVhGuo26SyXCRNyVWuJ5JwnLoWVZArU2r0JG+BDMsVdir5X/wCcsLOV/O+m 3INEXTYYyQDsTPcnr03AxCaeEXLkOAv2xuxPQE9N6e+FX3z+WEFrD+XHlhbaJIYn0uzlKIoUF5oF kkYgftO7lmPUkknfAgsmxV+dmq231HWb+wjnivBZ3EsH1i2ZHikEblPVVm2ZHHxKabqcKU//ACd0 vUr/APNDyzFbRKXi1C3nKI+5it39eZiX4AcY42ag60oBXAVD70xQ7FXYq7FXYq7FXYq7FXYq7FXY q7FXzr/zmFevFZ+VbVp2S2nkvXeDkfTd41gCMy9CyLI3Hau5p1OEJfPPlnSYvMHmfSdHWYQrqN7b 2JnUep6ZmlWMtxDLypyrSuJUP0QwIdirsVfLX/OXNldR+adGvTGBBd2Bt4JKryaS3md5FH7Y4rOp 8DX2NFPR4AwCCpXkTWh2rX2wq+3/APnHm7uLv8nfLs08skzhLmIPKWLBIruaONBy34oiBVHZQANs Cl6Lih8O/nP+XWo+SPNtyZYeGg6lPPJociv6nKFODNGRyeUGL11TlJ1pXfrilkP/ADitoLav+YR1 lLqKFdBjeRraQj1rgXUUkAaJQT8EZb42PSqj9rZtafYOKHYq7FXYq7FXYq7FXYq7FXYq7FXYq8E/ 5y/83aVYeQ7by6DbT61qd3DLFbSqXnht4uRa5iYbQsXAiDN9pWcCvxUBZBgX/OHvla9m8233mO40 /np9rZzQQX8iArHeTSRfDE5/3Z6HPkU6K3xfa3Qpp9cYWLsVYt+aHnC48m+RNV8x21ul1cWKRiGG VisZeeZIFZyNyqGTkQKVpSo64qHxU0X5ofm/5zimHr6nqPOGGS6Ccbe1hqeHqemnpwRghm6bmpoW ORbAg/zB8nal5F87HSdXtjdQW0ouIhNyjivbcSn05OMMoKpNwPLg/Jd1qGGySgU+6fIPmXyr5i8q WF/5XZF0hI1t4bVFWM23pKF+rPEu0bRrQcRtShWqkEyDBkOKsM/M38qfLv5hWNpb6tLcW09g0j2d zbMoZfVUB1dHV0ZGKqTty22YVNQQkGnxhobfmH+XvnU2tlFeab5kif6qLRVDPL6jALGI1DrOjtxK 7MrbEV2OBkQ+8fLV7qV95c0q+1O3+qaldWdvNfWvFk9KeSJWlj4OSy8XJFGNRkmCY4q7FXYq7FXY q7FXYq7FXYq7FXYq8l/Nv/nHbQvzD1VdZbVLnT9V9OO3dnBurf0Y+eyQu8ZiYl6/A4XqePJi2Ck2 zn8vvJlp5L8n6d5atbiS7isEcNcygK0kksjSyNxX7I5ueI3oKAknclDIcVdiqD1HWdH0z0f0lfW9 l9Yb04PrEqReo/8AKnMryPsMVSsfmF5AKSsPMulcIVDzML62oit0Zvj2Br1OKsM/MvyJ+UX5kXmm rrGtwQ6lbM1tayWN3aJcS85OHoN6izF+MoIVQKhiabk4KSDSafljaflZ5R0pfLHlbXrO8aWZrl1a +t57mWSbigYrGVH2QiDggHTuSSVJtn+KHYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7 FWJfmN5MvfNemWdpaSadFJbXAuOWqaeupRiiMoMcbPFwcFtmrirFtT/Jm/aFl0VvLumNPHLbXoGg wuk1s5UxwkCVGCoF33IPhirMNI/L/wAt21rpcmoaZYXet2EcRfU1tY42NwhEjyxj4jGGmq4UH4cV Wf8AKq/y5F5aXqeXbGK8sZ4rq1uIohHIksDcom5JxJ4tuAduvicVZTirsVdirsVdirsVdirsVdir sVdirsVdirsVdirsVdirsVdirsVdirsVdirsVYJ+Yf5z+TPIri21OSS51FlDixtQrOob7JkLMipy +dab0xVf+W/5x+S/zAWePRppYNQthyn027VY5wlaeooVnR0rtVW270qMVZxirsVdirsVdirsVdir sVdirsVdirsVdirsVdirsVdirsVdirsVY5+YHnOy8n+V7vWrni0ka8LSBjT1JmB4r8hQs3goOKvm vR9P8yS6LB+YUkNvqHmbzTrEOm6HHqcYktlS4Lq08qHcB2jptuqrtXbFUH5isdf0nSNG/ODR447H XrG+ubXXba2i9K29SC7ltyVRafuWC+i3cjqS1Tir6l8i+c9J85eVrHzDpjfuLxKyQkgvDKu0kT/5 SNt79ehxVPsVdirwr/ocn8o/986r/wBI0X/VbFXf9Dk/lH/vnVf+kaL/AKrYq7/ocn8o/wDfOq/9 I0X/AFWxV3/Q5P5R/wC+dV/6Rov+q2Ku/wChyfyj/wB86r/0jRf9VsVd/wBDk/lH/vnVf+kaL/qt irv+hyfyj/3zqv8A0jRf9VsVd/0OT+Uf++dV/wCkaL/qtirv+hyfyj/3zqv/AEjRf9VsVd/0OT+U f++dV/6Rov8Aqtirv+hyfyj/AN86r/0jRf8AVbFXf9Dk/lH/AL51X/pGi/6rYq7/AKHJ/KP/AHzq v/SNF/1WxV3/AEOT+Uf++dV/6Rov+q2Ku/6HJ/KP/fOq/wDSNF/1WxV3/Q5P5R/751X/AKRov+q2 Ku/6HJ/KP/fOq/8ASNF/1WxV5h+av5jSfmh5q0uy0a2nm0OOH6yllIyQTPAq+pO5JZ0VnClRQ/ZX 3OKvUYfMwk0XTbS68o3OlafoN3Yy6e8d3ZvGnFI3h5NJIh3S4VGPi3WtcVQd5qlkfK03lldAuLvS b251JZWnu7KFZJWe4vLn0pRLKp9F1k3p8JU9SpGKvK/ye/NmT8o/Mut6H5mguBoruy3FnAUmkt7u M8VZaNwbko4PRvA9sVevf9Dk/lH/AL51X/pGi/6rYqqW/wDzmH+U088cCQ6rzlZUWttHSrGgr++x V8OYqmNnaaRJYyzXN80FyleFsIi5eg2o1QNye/vlE5zEgBGx325mHDhljMpz4ZD+Hhu/j+OqK/Rf lz10jGsngylml9B+KsCAFIrXfc/L32yvxstXwfa5H5XS8QHi7Vz4T+P2eeyhBY6I8dy8mpGMxs31 dPRYmVRup60UkKRv3I96TlkyAio+/fl+P1tUMGAiROSquvTz7vd+uvOhU+k+WUk4RawZF/cH1TCw ADuyy/DuSUUBu3XKo5sxG8O/r8vm5GTSaUGhlv6d+E9SRL5CisbS/Lv1t4Y9UZ4wWKytEEUqqA9S 3UtsMkM2Xhsx+1idLpuMxGSx31XT3872Wx6d5eacxNqbKg5VlMJCkB+K03r9j4qUwnLlq+H7WMdN pjKvENb78Pn+rda1noEdsX+utNO8JKRqpULNWMDkSDt8T/8AA++InlJ+mhf2b/s+bE4dPGN8ZlIx 7uUvTz+cvkufS9C+rWzx6qPWeMPcxNEwCNQVRSCeRBNMRmyWbhte27I6XT8MSMvqIuQ4Tt5eaTZl OsdirsVdirsVdirsVdirN/IPnT9A6va6sYjPd6fBNFbAMFId42SJ6muycvDFXp1l+ZvlPU7CG71j 0bTU4pJ5GR5L+aQtMZJK1CzLMol+rsFuJGB9IA8epVW335peR9OjaOxs3v7aS6vZmsYb2+WNpJVl pNcNMkJljuPXRHiao4xtyHx0KryPzp5kl1zULjULiKOK5u5Gd0jH7LSNIC5/aYcuPLwGKsYxVF6T /wAdWz/4zx/8TGKoTFXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYqi9J/4 6tn/AMZ4/wDiYxV//9k= xmp.did:B3C78B9D2E92E31198DAB29F8F3ECFA4 uuid:739939c6-5f30-47e2-8b2b-427d18b576a2 uuid:905D6FAA9CB0E111AC25DA6F3905B745 proof:pdf 1 uuid:2d2c8f58-b0f5-45e5-af12-045db9005243 xmp.did:A7EBE4CF0B8FE31188ADFC6C7E180C36 uuid:905D6FAA9CB0E111AC25DA6F3905B745 proof:pdf saved xmp.iid:A7EBE4CF0B8FE31188ADFC6C7E180C36 2014-02-06T10:50:53+01:00 Adobe Illustrator CS6 (Windows) / saved xmp.iid:B3C78B9D2E92E31198DAB29F8F3ECFA4 2014-02-10T09:37:46+01:00 Adobe Illustrator CS6 (Windows) / EmbedByReference \\asterix\waterproof\WP MARKNADSFÖRING\Image Bank\WarmTec + BodyTec\WarmTec\WarmTec_HD_Pair_front.jpg 1 True True 209.999929 296.999959 Millimeters ArialMT Arial Regular Open Type Version 5.10 False arial.ttf EurostileLT-Demi Eurostile LT Bold TrueType Version 6.1; 2002 False Eurostile LT Demi.ttf EurostileLT-ExtendedTwo Eurostile LT ExtendedTwo Regular TrueType Version 6.1; 2002 False Eurostile LT Extended #2.ttf EurostileLT-BoldExtendedTwo Eurostile LT ExtendedTwo Bold TrueType Version 6.1; 2002 False Eurostile LT Bold Extended #2.ttf Cyan Magenta Yellow Black Standardfärgrutegrupp 0 White RGB PROCESS 255 255 255 fyrfärg black PROCESS 100.000000 RGB 0 0 0 Cuban Lime RGB PROCESS 203 232 62 St. Petersburg Blue RGB PROCESS 19 74 158 Periwinkle RGB PROCESS 127 138 192 Maltese Lilac RGB PROCESS 206 203 227 PANTONE Cool Gray 1 C PROCESS 100.000000 RGB 241 240 240 PANTONE Cool Gray 3 C PROCESS 100.000000 RGB 213 212 212 PANTONE Cool Gray 11 C PROCESS 100.000000 RGB 82 79 80 PANTONE Cool Gray 2 C PROCESS 100.000000 RGB 229 229 229 black PROCESS 100.000000 RGB 0 0 0 New Color Swatch 1 RGB PROCESS 250 59 14 New Color Swatch 2 RGB PROCESS 42 128 185 PANTONE 2995 C PROCESS 100.000000 RGB 37 149 190 fyrfärg black 1 PROCESS 100.000000 RGB 0 0 0 New Color Swatch 3 RGB PROCESS 244 89 169 Adobe PDF library 10.01 False PDF/X-1:2001 PDF/X-1:2001 PDF/X-1a:2001 endstream endobj 3 0 obj <> endobj 6 0 obj <>/Font<>/ProcSet[/PDF/Text/ImageC]/Shading<>/XObject<>>>/TrimBox[0.0 0.0 595.275 841.89]/Type/Page>> endobj 7 0 obj <>stream HWK W9Hf _7d&ډ*4 sOl$/u<3q N+uir`׳ߟ#/[=c$i^Z:g?S{q<`3 FBxȧc9`bݒʞ1<<~eK}k$;S8Evyf8އF<>"ZwF`F`EmN~"+hX3KqN4XcRQ8_1u;OflE {Nu=\MK||zJOaXO_w㷉?!6:&^n~_4$~Av9kgMy d?35~s ybZ/^kS }赿?ǵv|%m6gT1 Y+{}7lse;J?L؁@pGZn̙pH/8NI0( RqhGF}1ن`^m, ]']uum%+Fq$88kvH!"U8?}r3 \R֨-zoI X~̨Wh605袊.*a&sYJq; |]-34vk4]&yޣ9E BdؽXOȹshYwL`+.H%bL^8g]q2踩n[rjD+i Ŕu>ooP+l'y[g~TEA'}.ː5%,3))9*Ѥ*gS_n\DɁ2yt pPGAQDi *?Lיv,SÔ :2-Rv%D"]irf#8Yq|1] 2YgC2iA1A>z%6V[JC4< 8wXݫzm%ZHhz`[#,6#܋ģa^ :X L9B0˘aFq9Uxg\Ov0ݧHĀOG2H+%0l7^aAj*3ٜc7D**U`5$獢ra[ZhxZjz#o;Z f}`N;v3 Wb58K7j$d.Z(Bz"30SjEC$.Ax܆V(jK`G@ʲd V!IRD @ w\0 M< ؏6uPņe@3-Z;x+Kst>{DlDq}+/T4"8 9jfM"$)D66*]O )R3 2 uQrrR7鲦.ꡉZof0g-څHUv4%u&l%)K Aݕ,E<[JיДZ&T5d҃ԁ'CͯXXsKQa{n!Z]>|')g/cLƄh[piΗQF5x_&˕G"-)ԜډE4c,H*=}uħ6. ϢMF0[M X(5hYX9ńtrZj5ͥҲty|KU= )Lࣽ&Ⴀ/㮟 \5*jtk&#US&4 "ɥEct#GC 4QO,X_"?h.CX% _Ta[iAy>%5?[鑤x=ʞ$)v $`G)jj+܋] ڵ"&kbI[qdQ%7M52DP\hUK {#y*kJ䩛Fiv|I l4aEpl-C(4EըaFA tj( & JlRHu[5d- $1TzۻX#0h-&kԨen`<*8yI|]-v?<~Q#DfUQSXL=y&2jeG]2(hҵx c26jRx9A({&ʾ1PVna6ܪ+!Ul TfqjGKnHQw}=!xAu㭉P>B:P!_7D9KrB]. WUJ$$ׅ$T ;P% .K8To\E dФ?㽴._ŕ-.R-jyRjnAcOb.B_ȝ䎜Wrb%<wcS`J.$x^$$hJȑؽ^h]}`q2Te\$2A4EHgR? %HE:UlM:֗B~/SJ\4C&ӦHWÔߕO4`~fiVn0fqpW44(HTDhH Zf#C2S&OѰl6>3{eJd1@CuctgPR7"G8M=ScBpf0pY1lnņɢdS ͊ I 87NTF}|l"m' 2d]jC,٘pZ#d+l*COjH6 t-wլx)P bLi붥 d!}8z^{ڣBL ZEŏxMjŒh}8@؛uÚCK1A#[T44L')d03_-#yfDo0J&D]MoNeꗕ$ٮ&9\{R})_QA ` oEȭ8dauPgiKΣȡ7#N1[N:sOtߏ(oEF%:=>a,:_-7d`>D1..7@GͰHy_2ƆK5k5A5Z=bP/ `*EJau xD|bYXhֽ's1G\xsHXiyzz@?~o@Ra#@o5Sfݣ;,$DТ :KtPSn$y!g!/TSﲰ=b\a8Qp!N{B$$ks|68&4Mﰤ>繕<ߑ?P*1>:=iQ'x?@'Q\3+i! Jl2dnPާ4q> Xʍ'Cָ]^@}H2os qRX̿UT^8%<-S,)uT鼟ξ_ bʣ}*2IypJށr'_~ϓ`Zz% P Sc:#tAd@6eA)uiۅţii!y/m 9r6wK'n@s#XCw'#F:7 笋4q/j5{ ?>UˆMb]Wu9vqL0bc-`k×}B2f-:C:!h :K]\E|Vӿ=qw$u(\@sXiP %i9KV@.QۖS#ނhɯK{&Wy:H5ʁT ]p'6ty4 <Y 7_|.o} IW9O9rZ9sZ9ݏW9*)4IMSZ4Z㟦vGjڹ_`*ߟ͹ϰIy9fe8>BCm{zMK%+Nͬ¨eW (ުkއF#vf~Pdlȝ7G >׉o6Y&,tw!fw!E] {18_<ܲ; B_R>fe6Amֿܠaps3z2QziP"B9â 0\ 1}HTm4ߧ5 ˂E wB¥cs^Mr:PD|h Fce:q~g#ldjq,EbY\ihܲ;ִ5l䖍#7}d[6>2Yѥ)# }Gq|d?bf|FD>v~*8A"hfvo+9kHbm'>v2NnFh'ίOOZY\Nj[d~,(58{KjS e*e;c,#Dζ`<=6|pGc [ɖ@9٧ (`of }̑,b$CrW9!q+1Br2R_k+.aHK&!"]vO*I8o8%FJRs_hTGt)H56uztˉ'b'̙Uڊzza}bjZ9~yje-7r( \nbmSrr nԇCn+5YQ Py쑷Pե9XsŒXSmfs(Y2yC{4'Uģ& IjRz1/>GJm%1)HQ rosͼ$b;ig?})eʾZ2(XׇI1?k|4I# IeAߣۑoN*Wne!D%.ݙ\徯rםl'ASu:a~JOb׭"Rk!ήnUlxLG/;k+4 FŔȟeoOe\XSҕdȡ-tv¡9)Tdb)*DI6^˖KOy3\ww=J F B0&bH𡂛뵣X|J8[&?=5lWS|NؕROQվI_]ѝ7vQߓU P:"}R:(G`k$Hx5Aµ^ݥL7=& MKԳyh0g8a+T _az@O|*)O;eԚQ0r$+ ͷcٜ[H/TK˿\[V~"Vӥ_kq{c#idPsٝ%/m;-`(MGX^f  '`(sFajc d:[z{oN؛TD $u9}&pm̃,@\0)tD>_Xϒ"}Z 'BAs&.p>9[S$'\,zL97KVW'"P#טp`FAA{>"rFl'L,YhoSy Q Fƈ {ɢW(r=]auvUars,Xyj5ߺ 5aZҩ])FM͙?ףXDLIUk5sOEg#u=ar3l c 9L 1ih/kf`Z)>gn{B$=<ِ@GON!R{gOFѢ6a&J ym^ pL"g/?&iin`Rxn̑h!QFO:JVrߴ`8b> KhUhPID8 zr Y;.4GG(S @@욇gI qdD/w;z6cM=RVW[֊A&,#3FN\&+t 煄 ā1WU>g]!i9?h mAA" >8~͍>ήonh͒ng$ m$3A^?ܼ{c!9X("zmwwíYlx/է-a{4aužyϋ|w-8 !$L|  WQӢ| ]ļV%lU8 wkٍ^{ Dw"0e`Yowo{gT*Qs=B6M=0y[ت#}nj D3l_?s29Z=":쳮qs[S5ab5̚1] ᛐvBU37x\mz;|m>/V'>rp{\#aB3vjxX"a0 ,ۻwf\6-Ꭶ&Mjn n1/JxzJy=?&?kaykXvfڮ6_̵V~j_XcGH~EjyXD;ð1JqNJ[q!r! 3i\JCw_•FgIzMUbp&0p̹cH>gQn[y܉RU1 7TՑKRtPމ$pt{YǰC?%]l5dbz<dB]dBu h{&B"=I($ Pl3V`®}j>H8|A`1s]P/}D3~٩B@RvFVldbNf&D0]1wC/rХizӄi/*?klRY5 e_,qz qcG_X endstream endobj 17 0 obj <>stream Adobed                          jO    s!1AQ"aq2B#3 Rbr$ %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz k!1AQaq"2#BRb3rDSc $5d %&'()*46789:CEFGHIJTUVWXYZefghijstuvwxyz?@@@@@@@@@@@@@@@@@@@@@@@@@@П@@@@@@@@@@@@@@@@@@@@@@@@@@џ@@@@@@@@@@@@@@@@@@@@@@@@@@ҟ@@@@@@@@@@@@@@@@@@@@@@@@@@ӟ@@@@@@@@@@@@@@@@@@@@@@@@@@ԟ@@@@@@@@@@@@@@@@@@@@@@@@@@՟@@@@@@@@@@@@@@@@@@@@@@@@@@֟@@@@@@@@@@@@@@@@@@@@@@@@@@ן@@@@@@@@@@@@@@@@@@@@@@@@@@П@@@@@@@@@@@@@@)pyjjcfY`8\}Md+޶< dCU.5QJ]!kr:42J=׾;rA@Co[ޭӇkyZ.=x' nk.%mVfظXϤ).]N8rw}I|7/{?%JNNѲkQm,z. mg! cGGyطYU[%]{R|> N;Cd]J1ORrQYDݲ.&PEۯUIt-;;Х//ź:/ڪ:qWͮF^Z"lj@)789TP-SZ{׋8GBJJK̇؞la5ovm~s_žގdEX+é^~iؼߕ)qR~ϣGEK_)wuTcw"ASj9pp@@@@@@@@@џ@@@@@@@@@@@@@@ >”+⣧e]k^+UJUVFU'mr'znʈJbx q& yG5u!O ~8_f!іT}ϩ/gzYΚ MmkRݻ8CN#;0cNw<m8\k^::nR[WͺYvHt7[/֔])zқߋaaq2.X;۟-s>ϻ.лezMoaJ0"ݧ}[hq'Fm~ysEĒ9[ꢛr헛}ຌMt+訧^NufDv&FR F<9[o[̸גݻ9Ԩữ]%b .I%k;؄bJ1\vxje]d-մExݬ8v.9W.7=Eclԩ6U#]rmdLp7\i]z5׏4)J_I_/=;LgR r(/ľQq,.]a"ީʄj?=cmZিx;?}zqoOM+k/CP:/s8\w%,%dhҽ^J7(TuQ;:9zgMMCR5&ەJoO?鲖gauM/`v{Ik}V#x1w^y]f i}NSROFQom~UTJ ܡ+Zm&dXvM,H(          ҟ@@@@@@@@@@@@@Kzeׄ"k-IDb42H@9#AJEM]%˲Ej.oĕ;~I{)7oV]ڈoH~=pc3myk#a\,5]WKVOurJxz#a.JT#ݯ9+͵lޢ(_&8*+E<+x٧6'qR-q1{7Rϲug(AWQ)hjSq)/jtc;{f>'uk#)7xjYSѮ+zIW$xđD\I:GtOlzgJUY]g-6v]5)ISz$Z쫏e8`lҲGoLĝ.l/k h irT=..qg{FSvSypvQߝF9݂{7)6%IJS'7}:칤8|:ʵ/W~==cQ]Z|dy u]ߏ;wq}+ip:"o=fBzbkzRxwnxmF"vxEவ^u<Ү(]Fwf=Vx*\NI癤rt֬jHBSB7w|mۧJ^ٲ ѣN{߉w %&{gIteG=M n#֐,qܸ4hEIL66+=rUu ?HpK{b9l~t+n{Ns.vFغNܖUѮ/B|M~Қ*qMFɦbDȬ> @@@@@@@@@ԟ@@@@@@@@@@@@@-/K}n'['gOI adNVةN%4Zݒ 9Ʊ kispoԒQ]i_ 2Z=~ͽ F4F>ZoI+=KKUcaGI!Czl)RN^-lG |z6}GlB|e)=u *֘Z[E_K[yޕ!^2iG6'elyfc{m}7*ӂ̚>*B؍         ՟@@@@@@@@@@@@@8&*2ωMRpBER,-) oW.>63KY]_f^,dRRSK"3 {1j*i8" \9˫&zZ蝚hbm9=՟f.;\X@wN]wkySrMrf=6x/GJri76ӷW8s8ZoiNjDgF:Z#99JNaa1n lUɘKpJ[aGLXomo^1mVmhu.w Ǝbꪸ} {m]TC){ZH%ulp[jMn\|I@٣q[Tή;ڗ4*nN9>74$ǚ#i}-u|jSzI$s=KM1@Z8RrJ6CliMɸ8^1Sa:|X۵i~{\Bn)>7]OP/L!^{4c%{F ekoS*pZ';^ ڑ\NU;uk-:oJudcڶS\R"VS>8Mt: lIwk9Jm}|2av.q^+ O7EdGZJWT/Jh|c @@@@@@@@@֟@@@@@@@@@@@@@ S%Sy٬cK}pݎ՝uSmJH91\gkdF8rnwQ-~ b6 cCfi'R2N]CY5]|cke?M8 5oڇ5lGw6^]@kfm}u6 DJޖ;F[+r -eE(Toiŧm[kR1I doxHb%ys 6BtY-v}T-g.Qn}-dt%5Mci$dn# ̍|!CbkR/:tT؞;NuHmhwԮٜ]Z.GN^wV^- $Pkp/٤;1έ6?]Ly|;'hxZk+GPRH_^VE`Z+Ѥ[eo80 0l՜wsRa2Cb9mS\Eѓܚ9>^ڦ\6qܭ,*ޟc52O )@?eSZ"p?kxnƩ4ޮ}QT]N7w_^ Y-<c9НR5칬;$qsf禇*w.g>[c^(ioT~ZKz/icJ_IĴ/{6*YM{Kt};.V1'Ѭo*M*ѷ[;^M$Qg         П@@@@@@@@@@@@@P g /WBZ9:9{JFK`=O.I҂Ky";lVYcm >O}Zv\n^BIɦSvkb@Cs< N +w^8j~n%]%OiN$,ז:G]YULI$s-b$&fF|-8{(%gQusi٠k(%U{  ;-M+h|2ZZCcUuLʣ@QWv>R`M`{UG_iʧeѝ92%`gy{n/:+Js24"^ͰUR#G^+XKHFסVI.lo(^mQlu{kۮ0z6Þ4ݹ- g7No5'Ϸa ^9pV0ՠ^mvx)+ۏ'ɚa9d29q_quQM+󷟙grR+5!NIuo+u6" {X@O_EwBZa.l;Nbw~/{+?M47s=P^ư6k%plr\lxvI)QU!n:_Qo~*#9T4{6֗jaT         џ@@@@@@@@@@@@@:|j8Kku۱Ƹ\|$__{ؕ8T I%U1)w xMQBăbKAsԍ:,tQCy)>6kNFѽ)tY(NNqRkUvӿ^. i(+hn+,i{eiY{T_3HX3e1IuoG9 EF4--徝IɝY[88@->w0Ƹ3f^#~k)n7~zEVVcY\}:ohrꚖut%۩8=Sem%Kj`fCn^#ptREAѯ*98YŴ4y\`        ҟ@@@@@@@@@@@@@ M鿂eئOw2mw#_a@6>]Z)qߩQ$sDmT^dz[၁.)M))5{qX-{Yalxg$UڻʷVEm t춞[vάeNdִm Zn5G71q}Nq~QEg[DTڷ[q4ͭե%F4T׹Wղ|e.ki^cvZ_C"0cERj^Kߔj+.˸)mvsz]NQSvNrmŽ~!.W|q9CrJ^yuE)׆/ϳetFq]ɼ+pd^-.v'BRnh㿽) S,| IqVU[X0;eKsrW{FSջ)8)j;бJMڦj-igo&~>Kirߩ8INvj,Ky-ɩo&؅$U$jװeȽ±Ξyc=M5f|UMM9G^]Mt/?7;~% d {$U^|jzXtHmO{+Z?WM= 2pi$5C;3//u~2CE{RJݾV^//b:Oe{]=E?zͻpƋ=;Rmw[}1^^Ѥ0i#u;dTWJsZt`γn@"L(n{r~;m ͖Um=rjj؄ZN* *){cK;]EtڶͱlMU*-J8pP)T+(y&"|yk ^bs52]Ch(m~#ߦq=i7gnr gtTsU 7mӤW<[gQjXֿ-~,>pg8sr .\rkLUw'vZҳwd jTcXwΖcrF1ݻI[ޗRMPTww9Eqf.i며 8ju+漸ݮ}ò_6^se$i~wSݾt5Hi*QqV`5|qo)rrQcdttG5CK }n&#n_^h/GG*{O1KhN.IJͬ]uu0Ǒ        ӟ@@@@@@@@Hnu1( ë1\Q'ҾY4h&ǐS딮wGd]l%MiRIF1rK>cu sk_]M"\lN4;* ^O|.ޖ}ΌiI+eNN-uUᘕDtX=9G K CZ\iͣuŠs16Ki)ԕT rHwDzݞn-\4QqiwAH;+\d-ֿKfsHEQoK75=#=-aNU#EJRi'ͼfůN[\~   DQU:b-}Z0wo)dnV:ь&q9v\^yݞ75zҋw#d& &? Fk6@ܐv:5oS eq_ԍL7{ZȤG. ή `\o+Ak\F\o#\i~e)u{;dt[^ߵ-Rj1em%kZkF̒>>73p)of)16,_ >1KWK}XK^\@UzUdvi~VoFNߏ uӞJFʅXw{М\7RO-ǃ]ӺDp a6166[M--\Y<.inږAhiP㤖o)4ҳf>N:PovM{ݓ|˹Ь`1g        ԟ@@@@@@@N0"'lPR1qsq34s+wݗ_l;갣M^u$z'trJ<'6* b{cj|.ռ>6WHn5U^MnEo{morQj9C'{}%tw%J@uy&|U*e%lc֚YVo;Y?[х9NvI硬&tnݢw5i5Y4z:XoYqKh*NY\ۗEsMiݗ,;R֋ybS-k%{5qKįdNyUlqN)`; 4m>vF.+8 OZ^6XH7};h\k#^lъuRW^ZsIjH^3KqJjecqݽ3mh\4.|({ßh?`{o@JU68ʽwk'R*JkK6HU!KYEQE<Xv-sIy*M[RVZppm4N5f+P@@@XSQzZ'D>k뇁V:5iŭ2qv$ kvQeqz;;+٧l^ͧNz (BXcBHΚQvzy'{J]>Ji4+a8r!oh5FRkFGdcӯ-uSIx҉p$}F$B˽*fm&fma k ;|}utm;oc#,t*Jq dl&j;;#-KK`#3/o](#Ee.EаSl{O;=%&`. I`ERwVgc4Kwd#5c\*X\[U+jibUFF`R2e=5X/ '4 &o%b| 'ͯ fk@PEaW?b~Oc} WfܣZ3ȱZɨ,Zٲ oȗ[Jط\ZUo)t*b۔f{5doJ{]؃1l cKDԐ;)ݧ _u>OIdФ         ՟@@@@@@@ߏ0/Gxl?CEN͝)9z1#{4mW)_x^,9}tgEJSZv!&>z"}f}ck=/eDe4e{[HH })/~fKӊz|f~>'[kI5wUDjND%t䬛GÚM6'aw-)m]kݵvps4igk{Dem<26_v??+)]4\2@p9sFv[yٮ҅GWG6ԩeN?ٵjE38 xZf9p_J|]ʑiY*t&mIߚOm"i3a{;]ԍ\Eq׮wAe.7$*j6*\HG~[xx+ngy6۾VƅJ.nu21hR/ ` Ob?Vm$ȵ~SKu6v};><uCSv*%THIv18߳uлpU=踷v|[Gl**17J7m鿪VH^.,¨16C%%t,1u V-eRT'Ӝ8TZjppZ   āc/c#ӇT;0TKP#usgZη V k{ѓ{%BQ#jͭu+sU *l4.[w4m=b`=m;)IIkZJPmUoZ_V"Tϟ*GurnW&eRU8l<ⷘ57ک zVSsƓl&M Z'jO5:_wd)s(>Ξl]OXE ;K_$-/ 0{L2:mF;ky L˲sE7rlviqէ{Mt6(J9f%/wm|EU54SNHDM4PF>78濅a TԕgoWfڒoMUӗ$'(d8sdp͹DR3jsRklsl         ֟@@@@@@@>= kA$`ԒP m97rۆO 敎i+Hl`nnܷ?624ky}c; *:TiJP8^sI{7|SպG1EڒOxJsacvN-`Ma.Ѯ;=LvSvm_oК7@E u#{5oVKS|7鍵lNZ|׵nWI6 ?M4#~M-;>+xQŬGLAn%(X'r]nVxp:~.:| Fww]twzca9CtH6kϨ-w.tuo9Zj*5Ԓhu\}c7}¥+j++ydzmʴn}_.<Ғe=Cßcm0K ^_/Ҕ]#p?Hб#|C˒<4탗ghIԬp';iI&˩@@@N8p(q{*Śs}ŧڱLs~кjte1/G 0-km9,Xݟ=u8lJ/q5RVޓ]+OG$>P(H}OKܳVMeGz&2ڜ!A+~5\ȣ:9Kb tV0{+yk'_ΞUF}%utӂ!3Sqˠ~_nJ+ړGސ _Jl)7՘ dpoZzEݸ*L}a,~*\LѺ{suJRz2碠V)G;>rdp:>}X${h>z> zw*z\bd#]H$ʃr.Fx{ޙqW:t;ЗiwXӟ;ov7Ғn:WtKzлS ,4fLA         ן@@@@@@@9ԼCIdWHPdsAx.\O_4K گ/r=RQn$VO.-RYu/{zvq"77?t{1˵Xyak_+K8c<~ajY~kSb 4 /o;h=׉x5Ar7e[Y걱EѲ@c4\<ǵqr.WD7/m"ri޸>XfQ76Cۭ>wn35tcy^Wi|lŧbs`wMoe;-ꏯqW`[=>Cs}B-=ON6b;rXHiMGӻ=ۣoW5l)]kW59!{^*;]'瑁?jڟ֞vߞN3<,0f>²67beIÛn{Ϧ':{Ck4b +(Ng9;f[M:*I۩m |ބ8N!1JRL A \ e} PӴ=7`wtg e ]i(YNڥF; \-Xǁi-k6~_K%ZT%|y/3~EQN>M+Mt_5Ku?֜ޔ1eԆW?js_l.mU@[饵 q*<ǡvFsz4f Zֲ$rvy>ɉG$|7Zsh |mG:F5Wq럸֯(EkOD^=8ksrqJ7xV1bn^ETv{@GquiמY yw98ErWs@@@@@@@@@@П@@@@@@@!{Da?ޑ.%626h:X͓]dK0U͍͈7/aܶ dfiW[x .3D/q+7K﹈a4snCsl,zrzIfݽFT<='-Z;,Lߩ>THocϻM۝Z%^.ncsMk-ou\UKnD4V]   #1i!-a4xM]IWʔ);F*ҧ*QnMM۲I,Ȉm⵮]U?}1q-k@cO}V<qVj/t_;syY-;EN>inf}N}n%h;QMk ls ;[T8+W6q]79R,:L2j`Ր:N9Pt,DZYϹ<*{51Oϣ:3lcӲףQS{gV5v]ҍ;:Â8ČXAf@~Ovr49 مE+0Yv[M,{u:Bt[ 3zkkӡUY;JJSMYZI&vp=AOD(5pِ|ynWn.l=D&c] Y4۵#DeJ#騫yNj_}?裦8J|B:y c Fc1[c[yC6ug+/0:M*7;Fe%t&w.=|'q*ڌF 4b|UzT^-~f]tl{ӕozz=:5^U]*4ԫ)٭aWsGA B!kDqgZG+,h;a;_6zG(Iglnݧu'] 1z2pY֌[~1rj=5D.p&#=eDN3 {] <47 YKd8(IME╌yݗӆ5ӝSvg* Efkۇ6n/0rsqoz+󆱒_B%2:Z(        џ@@@@@@@ 'bp|Wq'M;(d\rBUG.rQK:Ź^*}K*$=ü$[r,o->BYoF} z] N~B+yF5Mj(W6aX?ڨiĜ}+.俵nuIqZup~bmm )JƂ> oFe~P9.`‹ ~[ 4wRp>2AZʽ=(\ж}7zOom;>xI6l/L^+%f3V] e݅,Os)C!smVEym V_E6sGz)EJ1S%ӌ]Ic6!NKyKx#>RD"6qvg t캊4%bMշ~'i.*ܔ]Ukؼ-^pm6 4NkÁ!}ߞ1Fh!RU%% 5y?k^~Μ0gg6Fj*C>bw1ֵy.vKNԇyŤ;]*ٵ{_MBH#*J㨍4ff=h¾M&^vs;S_S<3:<6& sYZ]"fet-rej7Ͼ̬8Y$Lr)`گ^TNKr~{L=g?Vod/~%Ԏ.s{qqZz}~Z#<^ }iFֵӵࠏ,fPF?r}c15 輴~,#ng\E/.|&Rz-SRRqm_z;bɷ~!,"7: CZykeڤwb3M{DJ5^u{M._vC[a[I>?4qQCtW~c-ς]۷ #xۊXUbğn:NðJ= +jjƯK⏳}i۶[RŻL c-}ci7[xų.r:)Y7nGGѸPld-m&53<_vo"5xJK=q_ѣzgѝkJq$F|UOQ-lb;=+>fS:hi.Mg[Ĺ[dmi.vO׹?bҔl':1&Ģ%V}ECI9\Nb40?ݳ;rԽkĻ9>G;~SM{z_C^sQ߬kNJ^MoF+;H7X?P@@@@@@@@ҟ@@@@@@@xĤJH434->vU_^ѩG݌_Ҝ_Fۀ[M|VWegHϿۜʶuu(7%5)53ٵ:ߧm$a+u>|%6W[SvWNSre Vi/e7K7d*3[  hMޞЖbN%;<>7ZImw0wyCC:w]~Y^;sߢm~W;4pߨ'b+> ~/n|S2ٴGfCMq"(}[rI%Vr4Z߸W%omd;fQIJғʓJ|۔PAQc+77lޥ=p-(Wnϗz.[iW~ރK rٟOf)>T2kwj4f,=h9yo$-7Bās#YS;(#lu81M &p-l9[rtXn)uhf+t*3HF?Wi$"d { y& 3f[T7[)ٯt(G}w[i-۳}Hx~-}=5fa3:.FYNJJVTvMynA.:9M8oCqz gy:^;-тU]eWRr aaS eŠCʭXv.+Fϩ+]ٺ{X9QnkD>>{V۲'H̰]HXT=C)؀8[tFe-Kܩnk=C q{wS~:?5P(Bw&6y=v_)og^_XɄ@@@@@@@@ӟ@@@@@@@>? IU, 8vs)Ihk|oRլ\Fws>Ht:5ٿmi(eo/R 7;pc#Sr~o~hzEإ9o-&v8uh_/0sw􍒋ɪIzgJ%d8ZKu"T#j@gspnUU=qʑM4[u۩rerf~g~Ů7W?x%wl5~]~g{&kV :3ٔa4ԣgּ1t2vI Ndyaqm}97wriJҷ+gl}!:sqӕXBQK+m{FULbtQLsZu}z+mYM1[V.jsZ.Qney]Yۙ'fS)`vܼ"!k{F{]}5y ViIFq]iXcna2Vcpskhm^^n{XАQ/Jꛩ5OWW͞zC˜l:X HGǑqseXm+&ӏU% ODYi/;P_J[%Z56I_.;+fƝy#47ΔjovpHv|1T=Нoʅ]vyre|7}m U҅ 4quUF 7_ؖ쬝({[`56}z*/gQwV?=oyI B7_=L&W9mF.Bwo0>- ! ]٬n?qVV4 41_AlrޥۣVkv3ߥ~1E4#3WR,]5  ʣTvFVo(tԨ=_ y6 F0Z ([O(LpvFƋRlw+*UUx5̺^QPv2_ѻAAG셍?R'vL4^~r97dD@@@@@@@@ԟ@@@@@@@q kx1L,"F|k"O5$ܸ&OKF[ y;=쫥Gtwt\*Ir~ &q'ONI]]jjtu #-3ȸ.VKR}XivcZ _/XV"%C@Sz.foQ_(3< II4UjX1(3ߓv |S6KlA|MFjmX~Tm_ƚcea}|-{sT/j:;ttЬ)_A{lrorփ9Aorק} D^;`ծ A*"a;LxN9Fǔ͓ R5aie}}M^'џe;lFjkQe"Ji6x˖+\w.6oWuƄn\:˧4ܷwUNKI9OF3MM\jsQ+=dIJ ohŴn/e_ΝE{D('hI^M+e@@@vO yIb%vc|Dp˘`sjU^92i[ϱtt:#a%ԪNN7iN֚˷om~hf<׌ͷMv{o}yFV~m-wgl>r-6w 9n/ěl-R j%7bX Ì7d 6~ߗ$F5ʹ^6kybܹzEe,ťi3x*xq|(6͒$}gToRFCF6mVz415\1R/vxo5^їDvt=^]LvJ(RITrq~^b_p!l=v,K@#'/%{R7%I[_tmdzMKIo5|OW.{0th; d3=׿Ƈh^`\cjq;nN7o|rnhqъ|9Zrr벪nωRx+ܯvc|S,39~,u΀Ou*:Ԩ9=Ou{)'/o}//G:c@%{n/#|wr9VD}tU:MF4q] eҷ;"/[YiGړKǏ|YA%=YGuE;,q·# e-nyX6X=ju3ކKgT%wc:seen~{}}YLck馋Rwfl}O2_$qW>O_CtLzoxoJCrE|]{-O(9+lQnw'`:QA]psvFCkcZ|[nz1EQ6 ܨIٙ [h7)=y;2Z*wfAs<$+iCvv"WVG&M4tWV>]>V;;O~=%Cl3Q9jd5qMJO,˩5v~       ՟@@@@@@@0C<;+pӑR.?[uyMn/2rNǵKaڝ_^PWVb% C6;pcmʦuv^?q蝖4= nOEzG!ө& Ty6ޜe;O E&AEI,CN7.rƆZ׵u*|]V|FO'zXb_{ 2>ٶ.ȾZX8`voǗ^^' U!k͚ ijz̕~eudպu?o-x?3“Tq70.C+kR21yKNݥ\{x6<>S)V;OU|ã6Oepk|`41 <@oV3.`6hH+V+[ }ۛ+J}]ڽ+AFlЛ%BRܥ'zp[8Z8TU`2QaT^όJfk! ps4@YVTr7RlED(ѬJUo 2UQ:dRUקʜeN)o<'zTw9-N lZ73=T弞ݕ_J$:_jړVvrmŬ'n:\ܠ#k)g{8-tvVĥFAĤıx!c䚲^ ]#&v7Xhۋ)֫h7hg{OBl645_IqdIOFbuU&Q 8:>Vձ{W9DV!9ֹӡN tmoksʷVI:pnqm*;Y3OF?I)\J{=:npQU=fZw,TXu>>կ푖qn'PmpA[EB{*i5|Uʛ7JwZݓӺ÷S_ѝ76J#V7+bKGG ?h80[eqv|Lek[;IOz+?ee1Ѹ۪.ijQޕ3}+Iz>&Hȸ0č"mkaaטtuNI ~~hqO/?hDjRd{SxG6  wnX~!$eaXҴ{7i73 ]ҎWv ;^_^ϙ'7]IIzP:sH^PO;FPn)M(g{i3 t~7ՕEb}4+ׂjn1VQK[$bU8`?EvƧ6KC]ujk|ܽLJQu-G5kYx51>ݤCިN#FW*FiKZKg Y/{8Q~N}Gȝ NjG#qivZ@nBTQ=,t]o1n7n]WsFwFiiJ({k1TUJSsHqX:1:-Zvqؽau[ Z7MX=cܩI<,]vyY]2l:6w糓83Ʃ!#f^ky^gk5K9h>WZQ^ekq[/>W^6\"igtS`]edhpTԝE{1J,xv x FUݲ3t84m5%ͦĘe䌬>lӫ':5ƥ&sJزk,k%n.I[kbt*NVԕsn `&uQ[G뾂RRKt8sifxAOxkaQB+R]%Z-G%|QA뮄=^))+vt3?rR>猖c1ZUN#N^RNJFٷ[X\'bFeM$i-|۞`yL5o<0}9*P +ufR.Jǔ        ן@@@@@@@ csY9[iZg4w|@*XڽEU^fq&zA[3qi恫OB+km$;x.]}L3E9_Y%rSBQٚ#L0s.pn ġ4(F[)Y}$sE6z;\R_GnJ.Nɶz

KvNWEJS%7&G)erwn%C ڀ6qRӴH ]!黹JUv=ԇdwTuu]U=ΑڪRwݵܲLQN}){8D||;46ZP9ɠw&8;!uBWR;g?N?&ˬLv&|FbC?z7⚱cv>Ԯ* eXz?m#j J?T\럷%&ӯs!R afXǞ[c)'oRYkv[ތ:;<RI)sqt5ES[c}\t}KIE/B\[*Y|,|\nom GOSr%H_}Sqz,wwo,̷()j_ty(hO+>QorFB@'^Y^$mOˇ_#m9F-GŴ RI$O$Bl@~[{y[P埯 [k{ZUUy]\DZ W8G]:zl鹺ɏGmYkD|0^oqϨUf>OQ=ϴs6v\cOİaffi:6aZ4/B2 ӞXRxz2<X _Uʺg{o*;SkrޑJyp{ vаm_KJ{d)i{ͲV?{R6U(mr6yJVP\JI-ԔR#Ob†b3s$`7wa,c^)㞜ÜV3c-h~mR2{wRfˀu y /ᮿG:SdԞ뇁"m[=Mm{/! = ;[p)קz| LA`3nd{ўIUeMnɧ~bYq;iQ)GS\nhMLJ}#3=릺Il͸cx|L-524l;Et[a^%); j[,w\̟zS}Niƅ9~KP']<@Y`r?h$1$ g.+_-瑱 ;5.aN4mFWI1\[}m^xawɥidsчrepih*/,uRc{_祒)a>ū%JcR 4;*)*JnR/;yF_diׯd|΍ьۑ~CbZ_SZc6)&ll'"ZrEhtgn+E>S֣V%ٱ彴> fik˘j[_>"lWy_bL+.5-h/+4SOIo3M 8Z aҌviYhGnoN}FͨC^8V_͔7e/<#9ǐ>lAq ; :RZX8pk?m ][*rI,uzt,A@@@@@@@џ@@@@@@@5w~60i&%,Liiq9ָsEFQwQ}ɲiu_qJ` XEcն qv/Wh}HUHA .Pom ,&d*x1\F;#t&ZK#eN'aY$Mpj m]Ug+ +#d8Zޞ_ n%ZeNɫtKzj jJSJ qYwi9J>ڱ$ܒ\?X[~c4cbl\%fSؕ}N⨌ Cպn~UMңgrb@70UNh)`#E;Ġ^U<M[=J ԖM"Y }U *jmY5/:ѢS3VpD;j))ɸ&e9;-.ޯWgf}S,oil{ִnI:)_+Ie8s4"ᴬ? kl }۩f^{EVuj*NIӦ~p6rj;(8+/'q* ߦZZP:v.x=K2%R6^]9 r>G־~-'mrgWtt=cO1>1ٟQYW5L2O+ysI$?y8_p-*Ry#꾃>z!Z(SۛUYb2L Ͼ\X~<LvCE(fٵ˙ +Wny.8N+䬥gwfvR;>| 'Ht[z|= i7\riFSoy=Z+\| (hXmxbV"~.S67 ׋%\ndڞR5)J-5\mt *;h>;SR|f6ͪ2Iq_z/xIl&?ۿv> ,v/6Yz$׮77U*҉؋A6sa k'Kcg+pn8 Czۑ̣~=aOۊ]KCQH\{'~ yQOwuߙע"^XS^kWrK5v,5͖١^mp6k_Q*o~fJמ(V)l6wjRkz髭SM]5Hs#TUAo|s@ xfG)C]`eSI87˕h;ZVìSޭ9ӫRFj2VWoh5-)N9&Vr-?OO>S%Hܑp;B9F^ҷ]WsvòW}ՎJ5r޵Nєe>dM4'y81|STcmuIn%*U% vjW4QqYXP_n^I*Эjͮ6dsUN?wX_dFvw)K YMYbpfQV5d5Mjl;%J#I9Ei^vOcٿzWmB}pKOQ9OHRUq+YϊW2 w>s9oC*K0.[TW'.oElha >iTڶ u+5*4nsVVnKIJi27br`:Fd%=dJ^6nk^Qk}mگT٪8lp=԰Z:Y$q{|Ґ\IWik'ܮ-K6Fm_yݶ} F0Jҍ8Ɲ8ݨm+]NyvK/JkpeUG7%:QӸ2ӯ=B㮅McKzQI |.YrV9QӉh.FWۀow4íc-߻ў̇m;Z'ק?)ȃv=wܑq+9lZ)Td=̼Dܹ9yߖr['m<;>'wDcԿR2;܎e^2'4g't2Fq|T5SLܖ3iW׺y5ٕr*ǕIoj]>=]i<3ޖ#z&D77-TGQM3&@#p{0T%<ڶ]N       ҟ@@@@@@@8_߇a)dwk m-$,u7 ͥf:,=Wӣ4%xQǽkuV T F+;-kYZ˭x6#aԽasu:V6H;;2%݋o @k䪮c,c/[J['iIBkj݂ko*iV6Fy{J5JGt4-9 oߩ=FUl'(M޳DqoIc՗$1mueRV&=e6Sl߳Neqps6#mNsӾKom+$՝W{dM#g763 .2|=!l:;lnUZ֔)9-KgzjTqeRPMQJ.0lz"9(q&糖ԛ皉Fxmdݢoe+^֒Ȋz3إ9APTS^'cEc'qrE%kymێhϓ.%W[L8c&'1w^]w!{# .VhѼ@{kY;([{oq;Sz_d,f]HΥm;VTܡ)qRPQ'JUWJ*APPGT$&]ka%׳ ^r]z_B_يj)߮7{x_C}*tm5ms^hVYsvjXVIJI͹<|;"㝁.8gFP6MU%&L<4=OA !*%[VS 4Rği,ֶ_+1RX):ražg7ս_T๤ _Cs*397z 5ÉP5q 4VԭmKTYA52*x0ߧ-uwhi 4ˌth k{9oWT0u䳫:ATN/?Ҏ;ˤmo{1#|vwf\O|y+z-7nF1]'߮n1^)Zɚ}lEA%IANi^/i=/֭/gj99a}w2zYuQo8w\]*$ε6tW)+_W6_)qK^9|tçPY8rnH4sᢵ}׻`8Ѵ7%,hl Sr5#+5z:uݭ%uןOc'J9JQp įq\kcGGŴ?req pKK71o2ZUJ5=g_IirQ_ o:?Ƨ{JO3Ʃ⪦G46H0 Qq<*Qqvxk^N@@@@@ӟ@@@@@̏$u3psۻ_0_ -Lwb Kq44KmSrkjo T1e/^ں{hɲҍiҍJi*{RWm">D;54Gv.5Cb:4HS ̈v~2V*3vw\ދ{.2F"{ڧ{T=jRyJ[/u[w}!bAϣCx{ e~![Ԯё[9?*S*գ㏮-}] ^ޗ!0usiK47ꄶ]Ai^~;sR AԆ{]9%kJ;7;c0I84qIG3YӲ 5k4XKh_ٙNVg;C57xܧUVO9ldl}]̈eXC&͸6Ul>WW#)FZp|ssh'MnJVr94I&,.8:)|;+e%c.<* -aO1b9SRĒZOiξ**jlߓFFKK%zM>ާOh%iЭ*r\՚$N2Z^ͣ1L]RwYl|]HhфWJiSr\GnssF2mK*o7V6EOl cbskiXDhޮR[vf](hgq0\CF)7d),XMtэ6$#Aɽc9a$wbAN-tZX;>#zNil"w:4Ҍ<VU|uZ p^-ǡ4v%Z8]o|78;{\#LԬi/Ma%oSԝoVڕW mWrj~F|qA Wi9"U'ͳN`^bC6q7,d'Nit5v@,FvVyWBUv+qoe;OBKҍWRdv9])YGFHϣ?ZF~9%oRo doM^S!SCT' PQy@ka7&3UmݞCz>`>}lS ԣI٦j0gb~\SkZT~/:ptgCIZYbŔ2IK\Z{lF-0c{ Jm_O,prW4]}9UǞ:5U8^8OFW;Cnztא (97őo}1]!a0/Ӗ듵i|z\[3]Mۢvw#@i i*hϭm/Myg붉En`rw~H9ʶO\.9)$y9}e9r!:rڸGKTfb;p/R2V%HgfNGM9OѢF~OX@M jוأԒafxnv|;q,"&8{Ev=Zh|<4uo"WK|wWfQ|Sw-񺢊 4k=~W.V;*BMgEjCvi$W;Z6dbH#+1>Z꺪Zxį}-ttOv3K;9Z>68bN9[ Z(f02 fw겇Es:YriQ*m> WeY}_W}ҽ{Cj6OfQRgjZ(-'~TsE2IdĈ$s6+.|d^O}T=ss=٫p)xz|_z] fߗQ{\i̢[\?ϑ6H>ӫjsHt(AslZN3Q9'n(&O\J*V퍍Alm\f3Twm/;1ޭ_lF~hE)Nr"v\m7^M%f=Zx,-̴zFtMzלRZ/e[9rxf%]V;*@5|JRQocKyb]c<[]V*(pR3$:Co]Ih;eS[ҟd},F+8;[ 2@=4N2PͭPx|qÈy hin *Żsgt+"k\I#ݪN+SnRw.aЋEEE&G*ЬϳˑTo=GLxbkZy.q~'1|uI\gR-$qc2PZ`k8Рʆc&xZp\k5Ez߁YMǯ#fqW+y[%@ԋt#kZʔf}9Ty Pլ]ݟ箭e=p Lx(5K3z=r.RKz9O>O|8jѪewNMFIxJz-aO}*B      ԟ@@@@@@ Og2trJ0:I( kc%}) +y+C{]+qY=M}K:9U~T{JT0Ԛ9KT@%Z7>5%ԷrqųqZs\5Lţ; k[^\(j'vUӵԖlVvegowZ{8vl{텹u¤V8ؿρBxH68TgnQ^˲溴6-6:lOU{7x&o[ʫ84ҷ_%7I <;EYne8t_ GV;G7>dv%h)-g?mQ[WM_(8uE6\];X]$Qfo׭H]98&:^ٖ|ո"vf4\WڗJ>Vh#yJYٶPNEXԱa8  ,QX0:P@.@kiWn댸ٴ ɚE|xghִ3Z;. yt"wǙCdߵ%w,XO svQ_%ﻜmsY`vcFU0'ä6n(')V_͊峵0V81GafX|In+ag=纻Q.N.-ސh@H/$̪o%j=@R9}!z@wc{41 N[>//a>%+>^ ThPN`ww̩nJY_}&bHvi-TZk 8;eBUmvN5gy(UX'L쥝G$=PokqVBm41Jt=zM^!+cvۮ-jyýKE4f-q7.؃~ [Xn_ж nt]K h'cBR|4n .w x-rˤq[xr툕jҨHk.Z\>f97|?#_]nu*Vyir|NA{)lcFquX)[au\\d,XuIrx29Apu\)t˕ě>emyUOt;}J_82snqǤh-;jVoF;Ŵ?+M"\o;_^}vɘPmvve qhHֻfL8u-(Z{dza31.ngvyu㓛}fW-XTV{Cv[Ҏ*G9ߩKїxZ|%<{:7M_%VkO%_^<EГ鎏ڴ׭׳%RU"ۥiKu˧.ixѼ?STZIs g:HC&*hqnpa-XʲUiʛծ+]J.Td+ފ}GD~ZQ*i8=ճN*eh~TFUj+OhΩ94ӷ(o&Ӗ3zƔ[܏\˛}jѵ6f^}J| Nӷʿ{\r}t-l,A;1 v(|馜Ĥrv{es%txhrNf9up)3D0]X]\Q.ztF*bW1T{Z5m_o c2]l]nV7{)֤i;^]VnƩ^]ښ[{A -RkSu+~]lأR {_6 ![-%Tkds`!vWw+u'9}'&KQ*U"<9dz p1 Hor6Gr7Hi*öcsy.U4|>^~WzOrJ?VrՉD@@@@@@՟@@@@@@ KֻOHIEOFhe0!eC!-b#q]>1O6o7:"IIU)5uNmF:pnbe+̦@kwYZݜK?X7{Nj*>)+c<+ r>@N6,AT5-ڷ  ?j9T$^y]q*71a7B $&qPj 'v[dYM9q<:#ݹ9nɻYYyeu+'loiF }ާGF_džuӄTq+cg69ҊTe9^wI; Wax xrGvU|?FN׵lmxRJo5B#lk-2TNҔ#Ej욖l9n\  ǰB|~i+wy!]>̿izk8zX۲C(S&d0̝L0B3A7&qv+}K0(rg[n;nq( !ڋxc8(uED܍ wCq %5'z[A[ԫ =zُ6m3QMe>8 ҧy()Zl[#č\s#I7o>N8Sk1wjM8Y>H vb6:AV:_i7'W^˖rge]vֹF\X ._W8fWfwX= K츌ZZTV}]ӱ]99)Bgk3H:yqШ6ȴ+ԧ<.x>DL is⸾+G,:nYk>#wG KRZtu7u޴(ԧ{=cA:;UHBQJ5$#8y$Ws#r #>>Ś-DFͱANvͭrmH0]ezUbO:_ql1:iّѡi:eq~^$]vk%yJYws{+_x`>JJ23g>@>QN$FֹUO{zIYv_F /}ߏ-tG})%>Ƥvʎ{ P9FTmM]4UNdjVUUaՏs0e+p dYVqvS\o{%>%$vqM8M<4+]<;Ft,'QersQ1} qH{r D}`%s!zI$ ,,8Ygz{[j-Bnگ:㸬{q $rO7kr7RZEgtz)uaI>7_426$W vOV!wnoͽzғb힬X{ht6ȣ8sҌ IQI-^6++YW8RTa0Fܤ#EA%/ҷ=4VNK~%ݴ Zܰ.KgmI:ԶINQ[MB^Ӿi^>U3-ROwM_rBEm¨sS i%;uIp>\-r@:#e4~[l'X5|=bF:%@hhi]wJ^=G3P,mOݦ7V3VWHykoj8f+;4zcU]ӗ9I9QWSջY..ĹM c\8 ?1JUJQ\RsJgƴҠ󕥲?mə{kqk3h螑+٥Z]/Q)ԥi6*QzI)9]((dmÛGfSxM{])[4dkxq{0tuU8_uw+;~ENamE2~{:sDq(I]J[ڗs=΋)BHGSp5+Tj̾ݏbo^%t#Z4մЧg u7'"_{]vp4 o{+}#W?m؃K]r-n46嶽Ň3wmF+e)圴8trJ$8IsmQSQɣT$'ZZbvU6.tхqmsÁ7*m$ U, 5Yjt.Kksprv(RIk߃)@̽U9K{̧2i'{+[By"`4= ꢭٜY^]ZۄM;5uf1)hi{Z ܖrX^Юqoag$NM&J[y(1Z~tx ۺ%V=W5q8,r"a3ή1qZLdYZZWZǙWkkzKݮIFXVR$AYA@@@@ן@@@@@@4uQgR@mkOWXɟ[;:OdÖA&]. ݔl9#-txFz c)9v%ao%Eo ݹ)'nzu%G;E(cX<GnEżH5ulTe%pv#M{@Fߌn A8դevu;pW{מ>$n}-'WZ{T笡Q_v|pQiO*lK!v KJ/l`uPCyrRT9_Sg_?K7Sd;$-4ܩoJ3R59J7 81jzgDt{ ;JAWj'mTSOKz?PbVKro %:WgxFSV6F=ݮ 7}[iꝲzjOgW:1:S%QzQv䌉"4\>3b=N:E8c:C-ʖTҒĪ,^XWKp-w\GUvμY&%xk3k٬7%iU ~*ޮR>gˢU' Jٴu$Z ݸa[zY.GQl٢fgM,h=` q>\CO,xЧw{O^jWmxHT" YQR9< c,Վy%z%)<5}nEZ]:v miuRꉧ4)F2 s=J s{$I7vX󶧶TES:qP`!$+($K `W@٭M.w*X\ٺ~ \%~UF=],n#7͎JB j|agnZ}#ɪ1e ߶.Qgy%ߝԅ,G>v6.]\ܭ^:lꮎ䠚旊k=k[ˢ`hktRg7d$ǩgs.݋\~*x.wفtSNxu鮦&|=_.|U. dhj5k\nSlzC]pMI;huwnys~%\讴:ךcSn-[\b]it\Ǭnf}Z5vU,#JԀe.oxaT.mYi%>=F{kpovM콉Q0[(䊏gf~'0IƆ-Qˠn- қw}y|ek6<_u;% 5Jԥ,Sb5-oows{Śapijk/I)o||a$[}yѕ-&] b-amw74i aS߸#鱎>w̥r/RR{˦ԋ5؏zzmWewOQQlq$ 3[Kn9nK't,4;|pTvyEvԤe$apoG'x"^!h*+%H)|>[5nz.]#f3lZ=Om!J Rq3&۳-sSQ$B覈l--p6 WO+)Ȫ Z FJQN2RWM5tYMaǑ^{uEݔھ_qoVkw\4Kif'ujQVY`5<ltQu'h4RnXvذ}]MGsqnt6X:ŝwyyz-7Tl*-N};qc]s\>:^_mK7\̹kEcqVOvSFV-:S$KZ୥}ƝeMgJ{m̰. hq J Vw]9kuq{󕂭:.C:{t5XFqS:ײ%2K#c,Ell:GU?RV}VjoNAmu6Z94Vރeޚ}N끶U@@@@П@@@@@@1.=qc!GQN ٯ5X >E-.MM|UsPTY5H]5,tfBdqNNkiAY2JQXe s H{/"ü:.i{<>x."]nܷ%y' eN9-l_ 5fl 5|=9ČGopԋvr\ÝX.7g2o.>|)ߣ[ӔwZЇ}NF$;_Pgv``C^%f`ӕDk3RVNܹ(6+C=!ӛ5?W5$骔_JJ2߃~Tf^Q {秛qX@q.k o29(Nj-T\px3ѽ۷ӥ/[w򻯎p>=x-Fq jޱu}ݞݸ87,n vF#hxt'B,Y1s n;-(I9Օd7ռeOFtʣߋ^!H2h,MnSM"69]fbw++` c+b0N z=Zݩؕ8玼n_]뱞olvW=/'ׯ'VĽ8Ofz7gg J+%zuAW!V.hb{ |$}9977R)-0r}5iCv:J0"ݔbTW$=d3䈀TZV)+,fUTwEBVNB$릾%ZTqB;cR7Sqm˟loH=pv1Gbj#0X\}[q:* r|v MYO[([mیθ)&c$^<7H^XmH̵ 6*M8yk'{\pSI/d5A]IYi]Vc}k8gZ*&]O䆣5uYXo2;.M3^wOF*7bɔE8'o i6ҝ!գlʝzCo hݒ Az8e'!Cõij@ʧǏG3elјoG{6T?WfVq;yQwFl}4oum B)1/鷽'Q׌wqjʟ XQoo&o:6|B\%1- [h4wWteYfI]vvOK%d(ժX;t-l3{ٶN"ǤcU*fIyF[;n$䋦!V< EOL0D{戵*e!-cGfɵUO svh]'1Og(UN^P)_+q]{ړ]} N1Y5x'NC+ !']-#!s{1ioEKmG4i+5w[۸G#eޔj`NWeu橥(QXǸ熽qw8x†ǟGT>"s[5cZ#ck^W\qzV1W[zjs-Wx<2~oGkm9$kաMӭӄrMӕgRNJr݅"Qǎ=.%lmL#JF:wdP:;}͸T*;ZWM.gew'G]y;rݾl쾄k=jJj4FYormmm79 Y'lOMb8~Cce[US eIT5ϽaJ{4ԬVmary9[#۔S]Zʟi=-F*hѥךOd].brS[13b4/ q0@x٧ g<1{I!v${5ihqkV/|3!K?aӥlʥ}NzpBwmnM)'6%C=Wã n!ƸMOA5dx}$sR5c@ܶUjg)eu>V:~ֲJ]+tO>ț^kVU[}VoZ{tҶvetw9 \ U쳭RϩnE܆n*n+yEJ6՛2rMpq+cŮsmnvZr͝[L{Lv6>*Gle7NIM84T9ٚcVv]8NA թ;-r$/R<;<_ mM\bHaDnPAP'fwwpkB teԢ՚i٦u(    џ@@@@@Ӎo ]bPGF?lhLr % qrboH޾ .}> CM50V; UTg/yy+o>J#A5gʜS}S8҇g3AC\ u:^,-k/K%o>~'ٞ}\6tT8(*^({*Dĉ\Ko'[* >/+zت2JKJKq{4.i m%mK6` ~-놀\BnI7#{wN'+ˉJz*&>Ki[ɵ-D'^[Cȫf/>57TagV6j4 DDd‹i1 .,#: hL=.Զo-'yQ[߳N07 Nr!xf QH$43c׶t:lV%拭i/<GzI+J5k(]>*p*A49$g 5xg{5MqINt<:JSiT7l|fJM@eNlGU#J[ρ #䭜qNl#}L+#kqZzzPie$Ѿ2Mk轗J#}1znGWK]PB+I%%)'~Q(={QjGuuXuE]I/CG׺֗k`_FOad˟gRᡲ]f== p݂J+LmE%vQNrn"%Ccd<jY(g]V`[8ʛu-kuUMjtI}aTȠt7 "1皧8v7RjάȨx߽oYʛׂidKHHtCYZog>XmKs/zC,qQ Z d, wn| Wr~<;K}Jr P5pst\μorƷnprgx++8reĤs2rm]wG8V^r~]lG^auqGS*n1Chnۑօi-/ٴ78qLm='kh O 8vG63/뵭SR;AmF׺ςpWU'#Y^-Gd:^ܿu6*;$u8>Ov;%q+r*FMuiL| IT i}2G<l9rKNVи&bNoGemlomE?UnO#aՕ5M1H^"lB|ukZ.X:կJIIpVEAt6yէNS݅Iz/Y((bNN-$WWw p9h7W)%bPuvJI>}&]\ h%Z쐼oxn?:ede;`hۙ.VTڰq)Wenh<|vsh9UUvqZ<caluDM0jWR#q05<IFߞַ>绸f1[xz%< GB*֋4dܧ?q$:"};ǙokM첍l{_dns%// :|S^6Zs{OEZc8[=AF ދmSE'oE4;KPC)k+ऒlMv H滵 ,֍7gfevVNPZ+bnoI}޿I[+V٫~ †ѷzRγԫԩN׋ݶV[KN:ʳǸo{}Y5t\VoƩw,SrLi(kj5tԡ/njM-i.$eWڜ,ZquX{A]i=nEH?.:*̟g'du,|c.]@;X>!*%ճκ'hTΖj];%f{vm^7VnƽVzWxguqmi9T#]*ۨI&8O*1~L_Mse,r߮iiM^=q̸|l}z1hmqXSŽ(>J=tC@@@@@ҟ@@@@@9?F>Mk>}%>S+G૪.v]v;]sx=џol{<nӧgiTqRkQޔD#ě5/QGCbߕUV|Y%QA&E?Yk>GhNnYOQc*J]RQGzMǸsUus%L9<m`F.Mrj.1_E6[=tk IMrMwۡR4ɶ^&OEXih%ENGcs,XW<Q%7+)[6K6ie&)8Nr#$5RϲC/lw+3)'ΧjߕijUS qӟ[+mv36-sIb+(%EUEd2߭Gg[W|-3Znlفb҆jK'lt/;?Z%$~R֧KltエPIƟ՜uhlso ΩvS0l@^JK#-T$ouMJRϔ10Aup\hG͌,丝֕u%#ߎ[! uviFDǁ[w>q¿j]?Hv6g˖{vXYeweO&ieZvqV/IFg=Fcks\IIujw*ڸnVq$[\>)5غ2Ue,%}Z]z3Mkg8so=Y;.[{$5i*6;̪8iikjpZ'f+{9@svLP{dmBG7}7{u UcFNĢ$c .VT&{]]Xub,4 ƹ 3pѵQR[6v%fߋG`)F2ѵVóIۍK0Tiv/yO 8qs+]7NQF- u]wlпcuI=Hlox7m4V:FV_PKW1j#4U{_ga/i;7w:3V+\j Z Ge{vƞҤsn?jPsI)ټڳx[eIs$'%pU=i$NVĖRKZmk}2Y2MevJ{ֺMsx#v ͒qkl+q|[Ks8I?A鯣T:VxBWM> /T_WO~{L5D|ǃ+r87cΣV ގϗܽVj?Cz1:U3 6M]4ΈVB    ӟ@@@@xg 5|KSp%זKF`/ZmT7-?BVM|жSEF[/V;ߟUX}Koa*6٩ͭeUz_)pHѓr|%sbo]yѰRI$^~\U,(SD+EcR{塖Gz<,_q}hRӝ0$~FU-]~_KF __L) gr.'o˅ՅM=S+C%WowFX # ~ خRI[N-5*Twk1N: <ۼo2O2NﳗQhTO=& $.إ6n<q;c:^wn׆gZv~1ͫXMRǗA9Fݧ%ݠƠx.e$VW|?iW[5SiMseJWisomhC^kEwm)ů~՜wUWN/kOuqZ {jᣚn ρTftbRt'g{SM? 8*0Jw}F=:s-6;McOT٪(EyZdIɸ W3M 6X{q.8Ī=[ww΋.?>S[vjRN$JY(SuN;&;}k"pe{{n]b]7CCy,'{nYM[<ҺN!m,SiMn sW$3ѵoz":ѩ?Lku3ISG˜%f!VNXq}{+奷-Xų.t6^pcj[}-R*MnA$Ғ꓎QUTbs3:B2lhkF4-`,Xi7NNFVF R{ɷ);MmܲTEQO@d d민q˾$StZ;Em[%oybXF#! i9KtqM|=ĔSYWʼ?|otN5BU|ҊKnP~k#sɏv0րw;nj'2Թ.l])6ۅ{ikksdx6$&;ONnr/sY'ϭ2NF^lt*ӟv7i6C߬u2np$kڏ;aǁjb 5ځ4]+*}Yߗ'YUe떏O#_Nd궘zӵݯ+)-z6\̫8 Ŝ=Ҳ Jg٭&Z3_N*5b.xf>~t^ӲS(Bi$ԿPv%X:–y*p>;T8o}Fnd4|Mp4> q깒ߧuӊ\QQSŌk\le6F[xG˯ ?dY^'Y*=dxެ5gq%a "-$Iy:]( /)N7~MK7Fu^ZSvSU$Z㍭+ELqy c ݬ-^:*/;^俳8.<֒~ްa TAPےcli [{ds,nt˿+._?<3詫AՃk O+ &,-Z^#4EO)mc\ww99˧P'F}yѬ~|܈B~5I'^u-Pnd ap 'x[~#f_.}t^r?Oz_u+☟'V9'81_ֶ2 Zch&I`g'⾞|Jnz/"پvJkO)UOK,q.uL QŐYA0^rof}Tݝ߬暿LoE,c@9h@XZ{@Ax~䮾<%p'ϿDW~7wEm[7Gu[Q8/֞*'ES S#J9椪k;9~cccXc 8V2^0kb缋t$6kM ;jזܔ%w7중Z8Ηu8QxiaUPMnͷ͔YSZ˳}V}Oo]ůk5BNuWQ9S{Dф*qdf9AGߥH|G0qX=󙨪E4$Ov2h7qgd,I_vP&lxKqg~6O_Gl*m_d?WR TEԛm]6F)Dp !'b\Iup"-ܗǴVXI$%]$e[-z龫WW2yЅ% )EbkႬ^ʖS~bv[jQVnbGi}7n6q!|u -zv[ibG׊ϝ 7>}ğjToI6ٕfJ|{ǵtᕦX6+#J[:OV}7U֫M>LimS;YE东c%[ztrmNN+AQ- oX^lq2I{vlf|XP k$Χ"qsIܴ\:5ům& ?%mlxkQKVM]3 &+!U_fWV5o2TvW^[>4>th¦NͿN[hV"T!Zi^FfIgSv+YNCbpIqK_>e||=jhv tm;ƚܯV겵KK߿pLu#iKHk#&3ůBֽS3WwpZ|^c76tuv5{99,e^}clpm$rr)Cl#[,g-+NT!ſ^.˜ezvŊ:Z*H^pndiV]2_Fe}lu8]{6P[n۫rE?[7و F \eC˅>?aJiZ괴Yu]=+pqbI,$|-6V[竝~ZUKGvQz_c+1魃J㢕JweYZnj9όuXCH hno`$]B1O1{O.v:,O/㒼=(шmcPw䢲ܥEo-UR &sŞxē1QC=-۾h淼5mhmWq-u-c=RIJe%Uf50W6Fv> $z5mKϋ_Bq .=4#7%Žyl;VO_W{.$E w}? Gy$f%wҁ ԇ3= [\_BYRKozNd x)i* HfxzuUYr{ݺ/PJ̢oR5hmkvǰ}-jٔN8{`4!u[ucSȯN2AtfKQV7J ŗ*lnfکn_q;Ӷ/c#qc8MAzw'$$gA͏B,@+%Vu}fk!4#:RI;7%wxŸ7'pL/ߚ珫s Z\vȂHn;y\J;ƫ͒{IҨgNr)E⌑S:   ԟ@@@@ s z(!Ęt7Bzk!qr@TǁEIm~V[>JUfRvc&h_K? ciOoekfx^~U^1r]~ }Wɥ^4(IGr$xO[=mmtUfGK3y'} Uޗ>GQ:P#䭛k+k'y>.!WQy^뭆6Yi*\~gt½[?"-I7![:~UN辇>Ajɼu%P_oʏljETvhWݞZwͰ"ß1Qzw&ǏJK{x< _ꜣt[/=q]፬h{{AuN2;=':^{<ғƹYaRHɘEr9\+IZ|0uK$v֚|fDi}5*Zr&^v0l9/HqGV_q^6U.0$~i?3P٢8MՋVBgmULmdk?"ӌ᭩.s&UK<;oy΃IlT %|I,4N-($ sK |F\%WUMa69c3!:]!ڤ%X5zaaxlYyTW;v`J[mIpUH| [ {We-k9ugh mR YW=V^gy^Z}y%<͑컽''*6j8V82M_vJZkŰwTe$fڕIN|~] e[8^ъKJarMpGEz3 L8o%͋gڼJpk f\zqw4׎y ]'}/u_pؘC[3NߨeK %YۼkC.t eBp|9'`TKΟS{ٜkwE^6m{߳T_M+9ROQsd썰^0ovXcue-||4U{$ޜJySruIͲJHqsp!*/僝UW28*L>#&.o~XT%\ƪG)~<6]]/4N. !U#9sg(IK+9iwШ)z͖jGIx]ph17|lylPvJ h2ۖ ԕ^=>;7|7Խ)RWf|3UM't^e[9eԦc=wZyGΝ7rm˅tZK+21ks8Y~ ;RyS ^ZKcٖ.~}֩}I˳l7vk5k=K$Fg9In<,j$fcԽdN9[F\mTwoe9+.<%{%u.mPcfV9crn-\%c27#@4+* K+׸>~惥>.RᄁSku]RgDPQp\[ QGeABe +2:Mr[j*wն:_P$vZfYkv64IQy&)-ukm ]3u+JjWŠ%vdO +\irH59mg72/:[կ'o[ϖHWKITGr%)ZSxNZNqk,V連߭#)EY&eE뜚v 5va_L[w:?yiHtjsJo2kW.d:;V2]|ҤixbV?^ %IǵNc|4YU۷;T/k}Aug 'N^3j Y&/nKrq߆C't“ISoK)7)w\RA_wA?H|Unw<\uaEus=f:@o%mU^*j%DIxZegGFIw*-{˪mq%MUSۏbOr,f?fG7vXF4٥ m^MwUSaݑXZǚ_"վ'mqέ<&SXWK 8ߴ#ܮ/ٿ>#v~Qa58)FWOŧrQb0CX#nXM*Vn?"GuEWqߢ%8Mg- ]"~ IyTQ W/o Q`kJqq}5ldo䷑8;zIMI+%)&.Z5} 5:MvnetkRVFh8k }hmO,MU^{d$nʇpE6ԯn7փl/p[oOGB=6u?2Ѯpf*[xרWиv7DBVY18M栔iv߳pyyN۩cz=ZnmPÚj\ծSY_0SI Am{G;*+|t2պAXO/4-k2M#\H"sd%En|.b1REnԤ|.tg`/W j:7 Lv|?g<C\t꛻ysx%qoNm%%|Kѵ\)lT#{oNTچ}ej')$SK6uN'b|@$4|48 H{FI9M5MPE<[o|պI_ewZSwxڰ'N'4sTc!6Oʳ8S-|P^[o'b:~B sHFxTY:C& ϓTϫ3Iv]r g3NVx^'iuw}&-W圩gx+e8RQSg^tۉ`H}xQ[S;lp?HTݵ:YwQbx_# 6uL|zOB'vןyhYZE7{u.!52'n_sJx8JژgCM5TջJZx47:]&\ du踺)4}~ŐdU0 4][8-[)3<ʧ;Gz9~Csn4#K_uEEʴ7*[Z4@cۙNWw-ߏlOGelFVI7o'l(>h^7=^<!ўY.7ym4.G7U9 !aiJqwM_8Pm{*Rݹ{dӼƻ~kuWUp8suU=;+ӄ)K3#-sZ[M^'uq|{.*>iS~^/`GWJ2@sQo W[47)N)UJ%=_x_h`MKk~yDoЍ=Jq~X\=Y."U(n,~?$&Iat pqrqOh޴SP3ew߄[,Zsh>c;WмkMmObin\t 8*>4OMIN;oޒ zq&èl6VDɡ9G:[N.ρZQv5w^NPq$(fiVh.R    ֟@@@ }~(Cd"pl 5uêI;\4%]RVkeRRJ<[iN=Flr*=piijTu'.N;jr;Q1i$ow +;r0o=[7[LW\._Ol^'l:Pq eY9v~m=-k}qgF^_VZ[9Fۏ\tm?Cap]RP3ׁptZj/N{Hᦟq$FXdN\\.}:U7^)9-AЃ9p8wMi(N2ܝ.%Sj3VfߙTԝsE96{JTZະg4vk*Mo^t#iT9:qcQ宧ìS& wu՘0 f| Ƅ*g/4nyYunL1^;&̭`Ol<-)$:":j9Z:z=/;=ZoXT?eptlڋעKuc9ogrqjlזGbm|fK˞߃ks9۾3 8ojC K4UmkE&!aԛjV'io3'4]쵡vF;eS{׻,sʊzkn̥s` .Y~!-'z)Y%yeaDé,oTRM?k WZN\d{p3%/!0-ֻa.7)GmZ׋o·Fi%alPj9T޶Wb.Їs0;ZX^s SkYUoK7|ۯ_{vО%▼ak\OŚ۞</^OOᅨ~%jrK,26M%M98F=5Կ84ĩnm찊2,Hmˣ>oIp]Pdu {uح6VYyzpTX2Ytv v:Wb3G+D@ iU՝wԼF3= F')Z6ŬY+ۂd-Sk΍'Qk=v^tԹլĂzQѴF6qZݚ;l=YQֶ MZ;4c*tO<b+Kq^fg4q %Çv(j|z>h'P6䒏"o9GREA VƧ\[s}o{Mg*L>H 7]rg>|ةs\3Lrh93&cK4%$풲~0IkC~^,UgXIh){5ԭ3K8w:uSw]VVo޾t^ 8-2k9/T]>>~s [57 7< uUV\jr>Y:܋qV;K?:޻klC+nC rƜϓ9NX\iv]eFwuZÑWW3 7pm@geJkNI%-;{ob ; fT%LICpc}ovR omZlIz[yC3tkYlNێNh5kQpw<඗~pnI19c?i>:œ[< 3Hގ8oG+?˰bKkПkjI*-$D-=ח6I:(   ן@@@ޚm8#IJN4֢R"}|]Wd>}?ӷɭT/y˺)q|{=sn\Nߩ7=JҋI9&}z`B݌cRI[I+pH-in A!VNQ:l1:Վ<%9VW%$nxw FdsCpA9ֺ*2|?J0N;Tm?g9GkhycEi \w@oYhyӔ&l*Y֝էQpaΎ˴ܺ4F5(ޓ\qt\HnT)}|x2sk_]w]Z7ne6صCMsGb:$_gTVBHm駊)h$譣~RHm>ܕF \k*Kuӑ]/vU N]tUVU6+VN2wbیǚjѩ yxM}٤{s4UJmBSW&3Ž]:uUKZ;?8>Ǽ8>K =N[#zVGbrӲj*DSOOGu>X,M(/2Z><Z rΏL:ro!Nj|m>=}3i2ܥѥJUU7&*tIEqwV4צ0n6ű8-Jfρq,8kjѤdkDnZV[8ϻCκh莇CiHTcEV*Vҝ9NR^}Zk2rӵ miģȝPJ,b3.0ې:nUG wwΈ pY>zRC:mvrQ6Qi2ߦjQ2k䮒g}Y 'wP:⏱׊D[uy;G)>~t1BrUu%ا;Ɏ=zدVe$7}4Tgmؽ˾y,%nGuKS쮾&CKL)E,MQ;^Ju]0p7 *{=8,YunwK ;n.{mHӏ4ͻ 5}+l=nCyeڲv8X^7O}*Ke{Ν8F1I+92r;mʳM`ED)mSfu>hele9[7oEm(iWN Ou(/-el+ ,|l0.t璤"v}O4gmMŬ)7Nw.^k.Đ4SG탻(k >#l\t,͎\M"kSgm3Gwzh{{G2^y<Z~Ǩ$[mk;5k'r JgY[#m7Bv]mu`lwo} /F]Ioicw٣D-`Hwiy^y+%nzKuglq{֧ NVR-$>j)\[yؒ6&&twMkv=phkMbEKq8n-[-k~Sm#=é6U#;r;g]3g K/aw].Q atn}&X\:\챹U k[c{o,3]LsFV}ʋgjj;[Xi]r3Ig`6p 7ܪi:]f޿LFNTk_D%WqvM +{K-с` ?JWBvR^~t ۵ޑk(x^7!{\Z]%ˊZdnzlgW9СQ|pq"vNܬGyN[Yy ?I.FcxF YIYG; 6trFC sy^3yONEKic\lCzJ#qF4TpʈY #0i ڴ74y]p]Igp5C.ڪlwtv[6Zv{9P:@@@@П@@@?_?M1W_obC]F*~6szޝp}>)V])[ tʕ;2[u^%s$ l-=vj>E!ď}?jYvvN-3-[ I.݌*3[**Xo{($Y;TkTýS-ĄFj vuY˝ןȐCkQzI8ݩN]T"ogn#忁RPWON<;K^Qv0M7>W=EKnRKhZIo[f{fg<α*oy$UFPXm\[93Moun޹y./F7eח؟9|bL>юix'&YN9}.wΖ_Sk5RnHRX:^%G{ϣ-".MGk]S=rzfHiWN${nm*VwGQoNh}c"h^u*o]%;|OSU&\Q[N)azvӡI=wvწ ONR=v\xE%.0r<{\"Nۭ~&/R~Q,l\jNʔp]zE%Fu/gs%M ۭ7.ҡ$hm&s~l7סQ`#UΎveŨEG}>;-sı223X^j8\nS>$So~iWgAz/]**V(`3CLK4ힱ6yZf:g³vc[-t>zZӍVNPu]NGyIzZvN4inɴ8c95d.Ye#`kZkX\[q~~*I<ײ]Z|>KN}"E:" V ԢSU"9=QToE&[m^+4O;+hZgau,,\أkf`q*kii{/g+qႤhˍ_,>ܶ: mJ9wu[wpQ-,9؋r>!U#砦2g{j[ɮ[eMUH.Xk~*Jwu(4]ׅg\ܮm4^ Upݕ'Q[ug}0z5=O=mlO ̱2SM&v^ kk J5fvxrJqkUkwOOLoHZS譢Tkst UbӔgNn۲xj.XSA!۽a:U#u#~J:F&ֲwlqࢲF;WZ9sL kOfƁK~]p㿄׃)yv{:vO2JRyn)E%W<橭- 16o[TIkn9-e;[:+-_\kYX܄w;oc-7{kc˺vKoJ-4}.׉W-lfHHmƖ'Y uc=/{]k]uhztZ|M)*u䛌ljk{<}AIǪY3msÙeCN7g<=R29Y.3W0ObfuHMp.R;nܬ0UܠoWYFY"v)rfÖ9oLkJqRnGkTR+$T[^ RftD\4#/:'m۳+$w/WÎH:-: ; Od&wXW_ jID[+5Y1}Tyeq&6OW/<+s^xs<[U2FQn)='xۧEQ;R.(/U. Z\ku~ mٍQpi?Cv\t3< {6ԫkc]p3ayĻ6e3'gv[h=ba$|M6p9HN+Gbk_ehmfhr>]kml",!X]]TUIvjsbA_Wo/o0YNj;,>hn\ĚSP4y_UgJi˹RJK7?)Н귫bu}۵JPj??yn 8cd#Y{y,[AY/~5mle5̨sZܖhwͶeJWfO{V&oִu #r/6ԝz輽'[ީ?]Vn)qQWU#Y]$=ssl*-ycr R]lfQ*qPcݾ/+/V{ͳI7mku^1¶Sb[Z]կ%|0SMfG~Ucr',vThьRoyŤ“peZ&0<ŏ#t(Ÿ1ʻ<)K x=_#&tS{@.o.5j2Q}#elNwm@$~]]330YEq|$_/T/nuS)r9:-K?.۞i9 ̞xٻ"cgʦ} :mNˉSBD.nnMƟRͶtو]y=68*nvZVw揊l7KZ=3kWiRpO-U+"ƓKEX[=4-; ')K_ ;2&e$f)ZmNoPҝWF0*TWyT_jyL9qo p atUZ)T݄?bv/tM%+\ Ѣ~:p::8 KjJnQ8߆\xTON@#i'\O8]ضSt-5:vj cZ+Fyw(^i&F/{v٠O掓~7=$Ry<|OJ{{}jE*$[c7Z:1y<{Yvgm ':ۍE2v,g@iyhXVeVw@PG-s'eSHl=ewTq^Ժ(7y9ůiGڻtIS\~'9XG<߉[bVU垌߻YRrL XN4Fu8ο>yms}-Iv<\ww=#}@tWڵZIݾGµyeiuqc}f5똻̭;E $ZtMJ= ݯqsW3Kv?~=I i%3{E}ǦF a^F!;A׿&8zev|>Ⱂ n4=+FWe&i$t_?SڿRfcјڵY}GS 3DZ+)>} 6]KyN.^Ok^{=HK߯-*bVLpX=݅cQBIU~%e$^29n- ױ2sbӾi.Z#T9e#NW_̸v; mh'N[ӥӡ,,o={sIpfw-{pjէgr<ڮE;~zlpV̠|sKcRi/aZKwNC Qq?7;%1UԤ;p*1㽧MTb[:'GFWՍ ;U 09*X;]?7FK𵊒x}V+^e8pYw/e@s%]uY̌P>ծ_q`1 idfb쎽++z| 8WM:gcZvyN뒖 ,b'UBz^Ǔmt\2ToMΔdZf.ޗ.#;ofH->…m~wlwu-.,ni?%MۉY c n#[9ޱmYo] "9/k&2.3.j*w˪U^Jj& 2vޥ(cKRRV;]Ѹ%sE]haa48%qI|= )Ԟ-*뗴nVgdo@_o5RqK\ث$`6Щ(^۲ͥz!}#`x!LuPٖ᱒C,^{v-Խ/zĠ照3ϺW/aOoKjU7')AjԜ%e0ض17:Eޛt)Mh&OPⒶð'Qx^;ԭTyaQ'}HS̏M{2iY M4d4ؐ ӟ%}i|?ک:rm^7iٴMq긠L؛./.3+`;wEz+xPKM1voj\9> ^J)n9E&*ehmc\{k㫵ԁ*ۉfzwW{3FqI84RMf^Ebym^ i{;1gtK4:rU%J7inc(t- :o{nns<٫*Wm`kjYIsւX4 9k뾪I֔z薈(nr2&+{ywj)খJ>I|ܗ3p\IV[+Gg"In+%{,.ųKmawi.󣍑ʓphM|\lnxLTMIecIp؍Z=.Wd _BoiԊE9SRv)>u)Qavl3vk13u{L8u#mnNDvea'~_Ku;(] %uN{%Ӓ|+]!N[8}LJp.Gnztr8x}v`X>M`3<1>-k>_v3 zGIuz..5 aسev~\O˓4v}g*V-o};d%s=n;9;yDK,jQJf/jKw'%M]LcOrn%c3Yñ" t#ؤullWMG#Id A.ĭIR}5ߘ]'v2g "W JiA/s/wZJY9oRO;suSB=JS;ApcA{^99Y7+uYq;0˘ܺ7uQ݌R9]hkz vzU/%~Qߩ9]̊A61z**N^UYOUUu*JMr` Sv&Nח~#<7\[w|? .;hDVR0-H(9n> zZitE%Jm4]g&m2\+ySӼ׷.m~I'uV>:8Jmn%Ս3:i+Gt˻6=G 9xF U=teO#bwdoRݾ1ϣ\\: ~8q\.2 i1 ǻ_ze~ku/){rgN*9t8ߪ%L`   ӟ@@@8W@z:y(jrѲ+cm_8V٫[_!2aCm̍"عwa>=¦slZz&=#k=ژQ^8ώ֏Ce*Yʧ+{mM~pF388{>l,}7Jϡh:vIKzgR!xE?RےV[2F_xpjwUDI;btM!򹑇fflt*mO8wwCE߆oſ<z[.^ee{MGUVbbM/-1B-{NXXU)Wsv~/Aif݇կJ){=*uE9N2읕8$ڶetJj'^2l9Y4R=lUo''|pw [fN~|nGny}]K6E QҤwwǫsF_~adӰݮݧ3j^Z=e=qՃ\?lt?[`Bir8;9k>J)}Krzrmdђ G%pEBK8}9i`CdSxE:hAnDm['Vby¶8uCk\֝ nKrɗFԜw)rӗᒲQaseQ\^;,QY|F?mU%yJ1K ;gESv?Xt7`Vs)TݱHdmBkxv<i\A:o%<ւV>ъv?@%昖^bf۵/?F7򵺋F/<~uΝ&o>[UϐlN]{93y>ԧQJ*__+op6ʤ]W㺵'>-=ˆg]{TFtz>7.o3 hRXl>ҜfcOxے| FmE'IcȮb6sW+lI=WDqT<lj'$ a6d9ZJOӒTd9ɺ|W6Gam4j͎?oC۱hFieE-Tjvdܝ9/ީFW9o0jNr%+9KE&IFH[e61f-_=F5V;^~FV^˶N2i]c4M\|8qw"tSvc~[QEMaO<,5p+nODҲη_'GgQcѩ$ [^~wqےw~]£f7bqi۱8A};4 ֲmX柲ʻ4#6WQFl˯As˕*5R[\]5k6:V;s,F1 \hIutp7)[wNQ o Sic:_A#; +)gxuXѻ.%UWⶲz;} EDsot/?u$e-g.pk)pg)c&N/ef78" Vv**+o&TƲK1UO2@WG}w|V5CTj#|OA@@@ԟ@@@4/ -alfi"u\vҸO{W \ {q:['v:[M8I% Z\gsIkyk"^ńƦyZީ'jaN0=ݛˉ"8﮺|-a[_)+uNG#\yJ/-ڊ^Z\_68@ÚfǗH]Wc%cϺs̓nm8'vNv:9p<ƽnc'c%- ^]tFy-S3grzyNa^GEVRu2g{%ӛ*Vo7]Qڊl5p+u+>ە#nd7fYY[Mr|WUoĘ}+0lZ jg2 { jNh]t*Q/WUs~ܩѻYynn6|y X^|~!m 5:4NvafwhnƯ*j,a, xJ)_|G̥EFqIx/K4.O_<@\}gǥG+Ug0]mSw*tܢޱݏ$dt8 P5qsc|sO*) "/}>ڬJmu$m:Z_9,X -dvXY,1wh7k@u'W8y+$Qp%' Ӕe(I4֖Ϥ1u[j$j9DɄTPƈ4-#Te^ߛXO>]* KT)Yu{41q 71X<A%=#)Y'dCauQTW׶wIa[Ǡg+eUi!(ԫN3UWn)^R3{v[?%xZeB>պ脑b5>H ;Gzi+v>:Q#]m;^QRo]>a} q,g$X"~]F{#f'y+p\/r{^|gw-pde[V6윱{r\g嶧W[7-#Ҽ]sA1foUeGoeTfA^l+"yfB5wdƀÀw^1wyvd~G[M>67''B#ET*Rjk-\#űpL>n\6X 1K\4jJѴtύ*F yGoGTl0vjE/X)Tfdtmn6qݥgl:^*gl#8+P)f,4u9k].8w?Jvݒ*EYzY*9JOvKSRj*(yaa<%E nvk=91)k=>.u掶yA6jo}J{z{IJ/?*f82Zh͂94qsyd.}B oaԪ~1K/nj:W1Kӷbn>4ęXoۃ`4"Vl-wTX^|.IVmMk>_jLGnI$19sdG$ԒI=NtFl/{55G໋43{u[v]#]VL6zpKقIrv<3i]{ @.ڤtU+-;['5 k.>{vov 4V%wm kZԛfǺfLy $g`VWQuXcse-y?ym-wn_o+f׾ soM;/ߖ֣#!/sq{suѣ^I&;C~%$c<'^e"hoU%Zm'p6*jM+_N+I~ ZIk;Aۺz̗νy߳Wn0T9s˹n6|:x;q9{Z_OtɷòͿvMg<:MRW66ۚoz JsIi_-ag̈ld6*wRW\Z|xkV<p~X8V*JzyÑavylp]hb'r3ۨ'uV4&7FvlޱFm;\!8K 6[\~vERP-yNhtX'D\?+ᕥtG+. K.Z)ۭý/>'?n)6WKVvA{\٧3k^gJ.Ɩfos\xUϒEW*G(Ӎݾ` eѝ^ 콚v|z͡iSm{C@/`} pvSlRnzE!-F{,wOwب7d.:^ ;(홃F{7`һ1!=Dgod~eXlg̓uMx{#Yb!I;yvZT[r=c"# i_Y;V;$=i 6Z7Y!=%NٷyCZnJ%+*I_KYhngoaN|9~*;+[6U'~Ns_f:@i"۟EGYJ[]gs71;@GgWw^;2>Q./IIWPѡ:Xj($v㎾jmܡkz/be73HNw벩;]Tq&NMִ[QKǁ*C>ARsYu{7:':[pr[㎻F3JS VspyQz*h퉖~ek;OJwo oI{Z/<\HvO [l&ixӼSә[O~JmF}{2?F7˴()>/~ɲ-V~NMbow8#kӒz)qw=5.0dzS_Mah-=DZ_?)>\}vUQ%mP9>9@@@՟@@@,\SQKG3=,Tu/gD؜^=QZ%RJ0V|EvZȫ&,Ĵofd(5r,Ź7}[yҎVK.~4 [^Z/JܕmSXIuOE蚱Rq5b#$ny2Hpߩh?/UZ3SXzNkwԿ(^/e^&evI јvesP^ɽ!Rd=isO=dHo]\x gWv+Lhn7;ϳնGժSVRT1~i(8#AW'kuͩXvWИSVqX%/E&L=_Cps^FRw1n )nJKJo;Qxw[v,**[MӖ|%oKwZ 98IܟSSܿP@7uv9Kys%ϙ쟝;s][ojsBTLHqkni~äksw*iw.cR'9T;7kv/U:.TVXEoFg ۟DR6мSoo]g > ;xshۆ cUhEߚӿ=2gGJl&ǖ흭6u5doSVԶjR9էuJ T]9E+9Qi3NR0e9St]D.N}]Eۮݧ|%ue޾62,?K۞[dwS\+29g܍]];Y;f.9;d.B,;'dks^:osu۞˾Pw2TiW?TJ zG) QUԿz\9t=hSNҍ q껊XH~MlDzf[m`;ErV*c}tB=|_ 0SvL_b 4 m0W/Ju}.2|Ϲ[fh:y%&䮓xO[hD( sIܝo{q~E$nޞxퟧ=VowjIb|7䁶z5}lιo%^{b)puݜ/]NܕicKEsR;IpRY8뇭 ݔ {st=?sVOQy2[N]?yǛcA+Υ}Q5f]&TMW\'*SiҖjEj9ǭ/y~=PŮUVbVu$i4GЋYIYCF۷{ ~ BK'ً(.;8ߑZ vz,ZJrj>͎.Ӱfpzj'$+Fk3%'Rda¸ZtD `R?U- 9غ|ߞE5nsO?'l!vIf[rq ^qmۋl4}ݢt\[M-zǁ6rtQ#>i>$, ;^{ ߗN_o{6}L̿H UTZ>ӣk1w0K2S;l>F+jh,ortUyrQZ%\dUwlj=#'2**6<KX\kZ˲2[˿vǻc ן5Oz+> 6HhNq(e=u 2WޯŚ3{ؓTou[F]˯*zǚK[fuUuɟUL; ;L{vz|ՌuXۮ(_kYlYU/]Yk٧kC8ZsY4|;q0- -kXj[Dwnwٿ yC蘆z^ڱZ4IORܩWVe4\X};*|K֫-x >+[S'͂i-{ s|k8'+gN|^KJJFUZM,0rO_Tײy +f2(|ܬծJ: .KfaԞ~mM K7^# IKJC kmO3VMջziN8v%[wT*/f٬旵>T h[5&]#Avz)*)7MKK6"nZ'TU"Q:>6ÝUb"iCv=Y4N`>DW WcN&BP=巒weŮ˫O.qMoYE=l1\zUe=9#t>#[KsF;pX^#T7?zדgCvP(oϳXkPK;ewͼp$>WeSyq;q_Oľ{ k١W~>I;V    ֟@@@9֯]~7zVѲT9/mJݝ]Yџ}7඘TiגTs$N񅑣xf'qe[v&.nr^] u˪N/ Y2~ZP)pf n}z^/$'g.(p5ôkCv03 sI`9t-s>6}ρ/kj5c{n҅ \;=NOG8yBY>"muqR@}FfT䞫<3=5^YWH챴IBkki7kgGwuJGduT_mL\oyF6ےUIxJcKgdMw!򊒱QmaQw);شrG눾"[gzy-FmK6m s#][ÿJ[5)% nV:Kh5M8꿝7WdQ'Q.8S 4vlC~ *CtIBZɳ'@ ߶>xW|N2j&TokUOgFu;VҞ(ZwûƇ*cٝruϝ)'2пJu|{r1-c–Hۈ܀rqTe;p\.} hoEYIi{VZ[oR UY~Sev\Y-eɴejn9m]+)4c:9Ѯz}^i[\!^Yc~&ҭ`,\|=+UfӞtu(Ӥo7~Þ5疺98*yMOoqpu8`7Mw>I!Y͹Еٹ ENwM2'g{٤@˝$0/ȇybCzʐCVﹼXCX٘\ـ2q˝׾@p1|.`|;@Soii[޲pxnN bPկ}ud)Kr)8>_߼ӂz_oUY^m4⸳5nCBλ>)^|!=Cqrmv3>o쫩r:m{>969,\z85qnq/hQ>˗p6nHn:\m/Hq&NTĻ~oา8.<;mG!;;`φ0YDZc{cpMIw*䒱ZY]^y۷r# Eqx|ʜ[AiW+SO:ItGA!'~^1iԪSpNi4tg?`@W.APƟsFƛyWne3-WOl.4+[ڽ 2n7784f@[ku+{vY+q,-cE[3瑝֬R\ee_m_[,[U)SZQWoYuϭ~ ti}vEnyZyRm_(~Jj~ln}V-ϔ>C06csa=t -PvϟJMyϟ=J_IP>1Zx]ޕV_%6+3K[ctwzu`ݲފ5/Hu|U{>I ;F-ߒ.󗖿"UվdEtީ6 kUco*д~sJJ}lc|Dgϡ6v~QJ8ϵmn Oiq+Zhټω?R9JMg{]oнQW|3CH:^]+UKR|} #N\x}HH-.]^SC3x;4ap.oԭe{ٮg6FqKѝ| %VC`@@@ן@@@8o@q!GҚ?)ũCh]w󭏦G]'ճןUԃ)ߜ=uWǁot;);8c U]V< q={QZZ;6F9*N\}1 ލm*)9Sc.Zk*pY&ٻ>|uRoUnk8垥s6n4WM)Eu(u'SE75qE׍W{۪FQvfɷˢʍU̎},Nr-O5MÏ:\iIByOO.q J<uRc~T58;J9O=bSI@T־X=wwN[K q_ww= Ki*ѥJ8Z.U_se5N<6v5kKe[.[nc[{qkiJ]\SyA,25ך욑N*=Z=\xk^sb-i^U;Ztt:eYGF^Ogػwʎm 9qv[jV汱[_(S|Jb:Ŷ6wΖfOZncXvи,s쒈A[h&ooknqg%a^V$pT>"kHcFA6i䷦_+=|IBwJ[LTS^*3XJ#tKk̛itnH\Y^X3}A]|ݾ6`#)]Wo~]c,vw 5E7|s{_u“:*xͱP5mrA27*fsAu8nږ4iIL ~+vJӦ:&}ɽmunْڠ;@/6ojY3_2`rncd6w}wN*e{|+5ulnSWw5+]dulp u<]i=nq?i;b=&?We:zǹ]FWH^;W3i&JǝJTRI._ sZ G.GVSm40]R;-vS׵G#~v#(৿_a~Z[Ȯ&MEccly-R 8[E\rI6Y/)5\GSe&⹬|NFge93u [16{K돛4`&%w/:0ww|KE %T:q>oxˁi5*^֮YEz{?q(@4Ĩx>$עֱ֣X<N׶ֻ+l}֒>>NN>S{6`5ӽ=z;8؏m8o y)Jڢl.>%3Pix.m}}ˮHmk\ߪ^{EHGr\oris;Xx.9sJ[\N<;x:_ˬ-z[gn<{,m$٭#ǮV.r$'߃;sԃ}gqGf`rB9Թ+)EE<ϐI/L!-.֣Qr}VW7.KB*u7򝒲S{Ν?Ӫu>y\2Hh`6T%eĸyj;=]YWWyv^os{I1?QpnoAˬ)yvw,#ЩtOs귽~vªj$, kAcuv-2tuv <[o#Ĩ8le/r  7Ch{_ONڿ UF+qk .#wsȟ皸aGFM8 1]IJݑ`\;O-$e}A~uUZζ^.iCquyNIS]xSO ർ:k.IewVYL^I$UKȸА,ismZUW]̐?Pc|kUHI0:7G(4i{->v/){cJ_[xV|@@@П@@@#OH135Mt8?ԅwr}/l]!F IZzCE}w㯞hFP_2-Ke&Ԯ/ewoquG~$ck*N-%g+|oiWI}5sr^k]"/ωqVx}aV*&<:XKUi<_K d*n_yT՚,/et)*6QR}Mx bG]ݽ0g%wMsT)>o)L'lMۉg&C:OobiJËdQ{ sD7=}J/ iOY\gVc%?_sXEvfm~<::jܙ}ƭ%ϵjQ`-PX#q+ms';'ꕗ&Ok)깽9P =I߂m,nG/3~ci^_7r&lM s+==,FSS81]QUXxw:3$0|iq{ۨs,k^+cK>y2`n~.wI58<q|χ9\+e 6w"ՉŭtxUR8]ZQ^))N2p?C Y~oFckTo}~|콤| 5/[!)f{ӻwZ_ķqr c:aN+%>ȧX;Z #*{哳̞%(Ң^t)mKÈW7;vexqo·Oy@$߸EFKFOu9t\4j.vHr+qWzx9;7;|j*Q+8=퀑 O6ip]hKy[8VwGf%.ri~%U@R o{š)4^~B3KvOQj-CWvd^~ ~owˆ~J2w+ii_aZJuZqx) !9Y c`]ŷJwVyԒ)iEvAc.XOF1!O3T+mVt#';}K>AK[oee',rIaY}XQ@o;/2*9X<ޫ&wx5|KC!N;i~NO<.nuloܳK0owrysTwZaYl#}IćNWxH>5lSvE5d|oAE--M/fDk@@@џ@@@"Iy<DxLR5\LTuwe] !AXkk%gka{L%J8MZs9ɭ1`l>pwm{Ynߞ0{T\gWlglBC;rbMĹck4NC ?bv)'kZ{.7\6)$6[ETWe6f-?v'BZ>^ZV~{=z}r?Gv;5\Ktgy ߬hm;)}\S|Ÿd}#GMVVRvT9ɜ~d"Kh9m/2:eQj{d¨nCrV7w;*Mbx1i˵Uz$;pt̕*v'IJ[+]7o.tic}pWZ/o'L3k .'G'}on40O8,#]RK@$ ۞۪,U|7[ީʸeJ>8_[i3X//SBlt5R TB@CK* */7+(cznWTŒ fkOG NYoV>maC-kXTDdhj]O$ :z[Fec z.!6MIeMesp2(!G}d nsXl-7_O؏ٚkdUkG*yC#|Y]ַUR['@@@ҟ@@@"Jl&tǍyx7>gݟ67|kȬ+˻ɳKiOSї`5ᅄwA$ uUܬ{S5%l-czY3-^\KsZ{uv =%'}k}:CG+u;Oqo'tBmtc/Zˎ5,g?1[X  |f{v͵Q[X1>E^Ӯ^+ƟQm]e2QvqK+J#3f 6oByx:?ӿLTcQ;+k3CB_Pk]MVv~>% uV.=WqNbё#" nTQI+!ҔT+$G]f;A:.4wиkyyEYs\3{ŕ$Ԧ([6(_../)7!uU5oWڬeR4llO>-NuK)kgMuS 23upsflWWiQ/t_؃ e rBһZ9Dզ!'ZzIH8_|FDf9neɧUJr|_5gJ_kK˫wy?8ɴ9^dq:7<쥜cN>d;xc{5*|ŝrw\QQ@,z\t=8iN=JKeJ^o8H[cฌSJZTY U5G,q=#ac_>YB$e/#,V 9e[Q\LmNk}}="wf:;h{=O/NM KBlwR8ZwjԩN-JR{_㡝荊]*N.-l+\gNWm(-Wު Bה"ݼJ-!OG6I-$s '-.ͱ%%w@h7Wg޲ykk/?[*ӵZL7ԭ&jSߴm9$(QiӌxE5M76J5Օܵ44Gil%oW١[]J7Mݻ9p&ζ(I합ыmfdӿVKԨ0rOG%[h,̰&-]>ïM;&g/7վ+Uvk:N"r>wRM|%㥒3pZߚlkuҋܗw=N*Y|5nOtʖm= ,8q᝙:CNT/ԥS\9 R2z6gUsE[MC}NzA?7d} n[bm,:TJ/#v͚!8zB!x.$uy_ +Z<1=lJ ];;w(QIv\כܛ.8є풮M?2ŝ=2jo]ءr& qcVEeu 닌oW1Om=T049t=fOk3O 4?mđ01r4/#lkIgL~qWߓkԼ%O)MNgY.I/Fr}+rة>gI5\n]BvrR U5Y(<5$|Kz+YzǥN%T-ȠV)d"i'Y"~Gs@ē{t>)S\ 5fm ~%fTnn=p;YtݱGuŖcf:.X簾Vv.ۍ*aJ쥵EY>Lq9:Z*[XM߰nJr#}[.\_bo_c5-H\* 3X$ AZnO$Ypu C\_y7z1q\%;;j8M5!s<\KN/)wNJ[NڿmcCU|9}!!olRPUiYv[8-AѴG6Zu}RS9S:+AzVˈHgfh|Sg[vO1fY͇i&a-;C>dUE݂|^[鍣low>Vv?I$Xm]Eql~Rݍبq_t4Yyyht*43u{"e_oݜm.9ܸq|؈mU%'hc^\zkxڜ.BѰ.x6sf]"*JSgV-Ԍ^kTA@@@ӟ@@@#GIieF]U_wLF@]ğg> *^oݿ!\6дsakdayhϲ5 +^>-ut4k.a}-B,q096c]yN6oSww''-{|y[S'܃}-ț~>MZ3eۗ#hNeouՒWgtJ~w75 >ϐIןUZO]9T[]OEZ2[ò8y)˲lssTGE*w^rq RQ:>%)|e1%]:вA*٫Ci[iu|q^Q6 3J>WtWKl3KcV\_QvT꾧n%ܿqUM3)SK(|.˕rݞKSBg9vֶU8ڟy-J譙7\I~>}ų]bQfv$ڀ>w0w߭ϸ.;+GnJ*] 45u1 ߒo;6KgKzJI/w~KF|x/8kC>M *u;ᅲOewf V{s%|>Z#]b魿v%Kk^TRShK5NqReݫ+%M3 Ku\K8QiU\pw\/gvXۺݶWЬ*u-(FrVS h\Y*]2´j]{.1q͖5w/\mz]!+&kvK.0 \n7:mM2ʮVjʹSj8Vv=̎sl3 \\Xۢm}RaI>\/|]מr2<1'ScR2^l۫~a-K` hwoCWӷQR~EϱFM,^Xi9?˜Ԓ cb7vku߯XxǗH=>ja-::ۘ?7|eTk-fd+T[qز|/yۓ57OW^C7=ԅsA];k֗,g)oJVZfW=mJ1JѲw\#mXAiacn_֓s*.Y90]1Ѳږӿ^6 ɝmyovצՌ9\;qxOJeI^ɼe讓iW\O$I'MuMUq螌s[*No6j:[8(e><pxYj70KMk鿳]N(Gn8ߏרc}7Umו8*I_Gx|LBZ6J[i;_TnRI?뻽h=tnKR.&jIpo[MbZͲEZM+>1Za7o=66 ueIJ}"v~ OBU̵DͧԪ]J-ìFwSprpQ[A]; ,6{HUs{ì[߲tx;]#Ün2ۑU}T̑W\@[A9Ϩ-.g4Kcݕ>]K~j^]$u,+(%oCe8(xۏ`&c8U?{W|N3E clVa :.S-*ÉI[zY.{tԀ< 5uE8 ېw*eh埂ЀoRhZ{gj>;o;=c9Z~5ģs15~pbWd:,S{Y Ժ4w2pY?[kkI+4?{er=]'.K7w~%FjNʹT߱ 7V5l9Мm+}:_Z=G~_b) c@o"+"+J'9h-u[gkVt~q w5V2Ցj'N6h*6H'ѵnSg BzYWj9}4^z:SWMjjs & qkOt8p/[+8Y\ sz=ҵ'Oռ 8?y7fj`Q30es j>'SCd)=lEţ zj~F6y[YuQnerYмۻiLkmtר[_Β?|2y*s}/՚#խml̶"6bE yW\;pU3[@Mk[!kOy"} q[euK=\= m9l m}'R烳Z+ir~oھ+>RdcmmnwsܪogUtwXˡ?fRYּ<&(6]x''ٶK->yqw|G![ s]O_oh)]+辇P[_瓼=BgӗwV+_4_Ӗ[cjM.M?rhp   ԟ@@@8 Cp. WmiV4ȅN!>USUhOC = 9A_dUnᩌ__om(mvoOV* d{jTzjg۩&˙!>ݽP|uHGfMԂwcmu|V8ز=# `˨oȨ[ ݿպDt©7|v$aؤF@?8oU(IDglU"_ݠvYSrn6C8ỳWL/|kcoKַ%[rsmSЛ+^/ ~򯶯HmSi{麝ީNq%ފ6KypzVM-3ZvC3rޠiV+VR8SW2hVo,v?NLJRKu+&K:&b#,SS=rp Is,^8VIitewrD#H$˯=Uem/nrU;=eETV˂N\yx#yW>WDz#wAދ/|[3O3fhf+iz[IW|v>'WOHVӲT}O ۂx8 mT|);u#P=+x9$՜_u9yޝRvUdr+ˣ2r\A'v~̣ %dIuibYp#Jy)^ @:)Udw@9n8n[_ҡhzܲS\nTV:f[: 6sӱۮEvU{$'n }AY2EZpܓqp2Jdb*zM:{l֬Kb[]}qZO\AܛUHOGTjQҦ_.~cPHV۵}\u\Sm,f3nU8G~T\/,ZV*뵽Փ0 vh'+-weOs Vԗ'~%`M \@X{Bݒ 97qϯErykZLYR˫{x)VyݹD= ~ڬ[Ɩ_ 68V؛`rvoqm$AjpYSѫy$&FJ9J\wexS}!a㩿.j_°ORۿ$]yA+RJ^ʒm ӂC*_t7ConEp]BW~<^uiR|-LRpCdX{sOjrWwJϴ>mnmF_Em/u9#Bqk}WI;uk}N9qyӻn-Nasf-f56`Og˿^ZٹvW+Snדŭe&;D5ƶUn8mܼ鮙SK.k~ؗI<:"JyIf&qG>τܨ~çVܝ/٫3@@@՟@@@9oFA aᘔm)It6_oի9U_$н5Ֆ#:%^2ꌦ; ,Rm ^åhe&%׎&9SF۶OF*҄&N^kl|M$xyG|W_QJNv%A-oӬlƬfuR⮨sGa-nΜ2~pk-YO/[.e} 0e}[ή|V3*GcᮦN~ m_ϗ$dʾz{$?Xpxv526>ɮYqy*N]oIhiwe592_Y`x0V0dMG۔Y{%|_ǏqK8ޞZ949Rv-ǽg?X_R{ Gb9+mkyr9J_tYV=%pv9ķQaQ*%W5PͿ \c{>:pC2w6QKZ'f9Q.Sn%BWFf*>Oq6JluhZrDYdv|[vωض]QO' JQʕ;)4c^_A?BF5[cA:Dž{VޝŽߓk* }rmUW*Oy]ufu]ZI5ɤ7EGtdnZ)'(7ۺlm2K;".CC}i5e5Y|3/::j͐t6h˼m{4,vRrOMk4 'w\@7˽ׯ]wBwY[g;Dig KLY*{Zv:Zgs껫="vSו=T[RvdiױhCY$n9v}Xߓ9?>n>>{<;JݯN3ۦ].+XQ]1s/XV py X8]q,ߢ{LHv%Jan_]ktLS#*sBþX*nM^Cv@ގnT-R-ż}^Zu}ScmCXڨ#!ԝwcK]}ZXwVr)4w>)Nd]ҩa$o? 8j8H.hiӐ2y'w +=yY#A*+cW]g|9reso{_ٲڛq}ֺyfv2h,](sX{[w?r)W6X_-.?6ZCI.a 7'g֨9idsm8ތەGwnt,]kf*fy?m'W>Kmx6cw ;&w;W/~_; l%C,Ol?Gړꍾ(WhJt)M椾_B foux#cj$i}L=[E-.Frl7{)&-Ȩqm!ڹGbGoqcC~4EG"@^M@h3sm;IؑE6{ߚITpF/[qWa^ƞX.(渋/׵aK/9GߤBN7%Vݣr .<_|po[WigyZ9:>Uzٿ.ͮa1.Ţvo+hyE'o𹧻.H Y+\lL_F~19w2S_9ߞꩻc&/#.z ag؂Wx;p-IXg %NEbRW>T596WGp-c^9Z}O 6 +#sRO4.W_Wsinګ5o- hcr/t>qxkf;Vw?=ELncBE/5SuY]_3=GjX\kלvdn7Nӡk]eْʱv^*|^I95Z<4Y1U4r{d3T4BXKV<cN=^+{݆d]I@k<@@@֟@@@0Hg>'m6_trQݣjHK'G k .]:.ogFw_=,}i\+h"~3o9Җu>h(i2]r9t滶ڳqHYGz-׃$'u+ٙm4oMgqC*wʹ}tN [I%{܅uWRjҋݣ%f9ANџCZ=w]vRY% iZո;\ݮչ=zr69KqRGGEq1V}ZyXmaŬZkZ[VDzFGy >amIN,wRJIVυ1vLdw --3!v< mЅEҝuwv];E4ueu;Cmvo-i*Fs )K}u{NyVv7i RQj>4=ò1D[KGL\brOmkPaސ/8Փ?98+hI߳lkT)7R  xCs7$wU5Gmnej2+ZZ$%T=1-a9{ImuY{OUϑjy|y]΢rϏ !( h*U\7ZPK~FxMdRn&ߤ nQcMĬs>_YFr\p۪4O)턕+n-$QU6Y6_ؚcTW|;KV٥VM.KϓwJ"7 %oϾ&~iv}URtl˻Yα˚Ӕ#oozˍٵ$H)5{)fX)06o9q[f^_]_NX 4YwY\;fHR;I˚@s\2٠φ,.f9Os[9it: =Vcwt35t j,=~+}~']Sk& FNҿl=,^RnY6W6."x6 A}}T흔e)^Zo.ks^tiYN gu'wyk"p2ǩ&x[᰿UF>׳++q_ĦҎV?gj=iv㦿/`-s94\n.oȌUm|M6z#ٽ(]fWJ][uͶnapH }I6]tǞ”OWBnojẾ+J8;͚)~@ۺFck:YϊO1_?8ؽ%9)R+]Yo6ĕZ[{ s!=UW}{]v~o,?ev[i*)relƵ/fm][Fg*{iZi+.Qb wBRo ]=oۼm>St!vVUZ%uB*\]c{@?:'BI'ğBHG`{0}%6JT[tޛ,41- xv@ZOM@f z/|q>ZdJ6NLjLnviF *`0prO.]/jvz8.8fQJ/+Uw+8zo#Ypes3@Ydobj,Cq~|@ؽ3~jËz<]ɰFc )c 9 [aooPLŷÂ+K؄DlTSa6>툲i]m oVqv;+5&HOVzJS~ȟ̥ГZW1x7W9,ƄG\667=9~ZA_m`RxGfk<-+Jk&].k:qfSC7True$ihJe]ϼ` *&3?_[pQu1~:篚88Vx;J><-wvn;Q1u)oOSܽVgq˿Obg6;I+䥔f(w?USɨ+rN\jv篂T:ŷZl̦`:i*\gMuɜc)B+3]f5w檚yi4^nkˁ}'B,jDq.)03_˶9@Xļ&:unPآꎣ]T;uŒ+Eǵ|1t%$&|s<Z=Ns5Jo)x~#z_ygOSUZQ-oWyF ׵5AMM*&%:/t\Ab1RӳsMҧhZٲ]Wzw.e5bsH ɺ nSz[ȭ71]!;.ؒ鳍 u*˘56;GؓTT1ضvKo+/}S&q/X\Emn,nC{향Β޽3ũ (.k}Ύpyo]>:>=WOϟ!LUI8;pc]z࣪c,_UޯqTqt^#ZSJ, -ԕQ)aB*]I7ãC6p:Oٷ~;I.̇N.У9JqKy P;C3t o č=6WqĖRAN $ inHn'FIq )w[ϝ Ѻ5_)J2R֗0ޗ)nc$Ir|   ן@@@<*W <]pp Zg:))8>+%MbN=[MKm(Q5}8,eyzvxۏtVz-mYCHZyxk,~~g ^gg6N]5n]*Z4m l4姹RNtvi56k-lnM]n͹w[/خ}VU|\ W 嘆!sk뢩c,uۼN\2ev8'8eu{++JZ Af-}G7Eǝ+{,viǂq{].Ilt[o/;ߖ:oo r18[:b2jH$6ɯ3֜ >N޽rlV-e$ۼRYZS#Cȅn@:kUmge9Wӗ QS"~qqm+,bD#>Wm !k2+ue%9̗8aB4IuׄY$1ruJݴ:&YAL7uS:,XZ=mz6VyU+nE$|cݵ#ǚG *-mw*$X^5>Qɼ(m:sʭ[#v']2OS";#FV,ˉue57.vROSB^t=2Jq&P>x7]y&E~8Kh9vsWzhSs(c4fzM]篑VLt=E p_.ޡὟ[EEHĥ>̽ 63Sk[r\@[;]JNO<~;ZIrOxj+>:r;_tғK^I$zp3x?T*qSnC܈ ?dUt2)XO,tvF^6Լj9Ǝ]O"ca0(N((_Mj\y_#Xm a.?G~ZMzɨ=-N-qK]qVMY/F]}|oܲkRJݔ-'ˇVqe[0w-_u\>?F11Z7vu/q@Qk||3u7:y<}ݭ;Y>X[~?x[Zê2OK=bYW~}uK6+cݺxPo;˞Kv|jj+i:-13ƹ&qӦ ˫d̮EW+h }x˘ĝu Xׁ5f@aUĤfY^Ym*Vo>~Txk\y9\>=c+mKA^0\]wnZΓHA]| mHixiCd՗պ";h `s .RacO߶HRz>JU.ԪaE)f<,4]4tp2 x6`Z4TGQImmݶޭeZ   П@@@]OX\<'/Pe,K_!8,ΛSh56W O1F+FA͐7%[ߡG 1Z'a5WIMrg7۹K.]TRӨaS,<>T=-_k.$?=#SycⓋ&+=#t\i촨I7)UMZF+/5M/ܷ0GZ9-ԑmƊ~׼ڷgSOWϑ*FnQ_t*QWʊ㕼cĄI!UiY|5QFS᭟7/} EEԱ{g⎋fa]sc=O.\^ۃۑ՞VܣǙ[8KhܬukKRa̷)N߽9/oD|hɜҸOʹ4ŏԬ^řj~]wʄ[[w%t֑:Á=epH2֗L:-u+Vӿ\#i_P-ʧ*k_!| =q.@u n̪Nˮ/٧~9226+ +yg_[)xm.FKF! /}u]fԖ<7iE&Mo7H+urWJ7ϟ9 ʽ e廗wk޹2VTeNR,֋h5-un~x缵Fz4&q Jq~4IO.(lQ#v^\mkCgHזYTǎXmd'0iݳO:MWNǻ~g?]4"OK.= }2\ߊRnǰ' A`7$rߖrt'gy)R*:w𽯛kw2k%E4oٷw=I>OO7iM5ڌ c3K A!n ׿+em՟Ɍ%iЕ8Y5,IMf/i%kj31>Nr4#Mةg:(/YZO*1߅o{{_S.@7>Q%*mmi`]s{]"[۵L~GBTT_3ty9[?,Um~Qt{DlUѫQR39"7,r՝uV{B!vw3qeݧ:,̧B59R 0 $JYA)*Z fmkKlK p=$ds4 NQDW7PKXr]GO2tv״ۍ~ʳ9ˋK_tlJ쳕+i*rkZ-]MȰ6]8IX wZnko$\vOVO(o?Y~__o3(^z[ͦg{ {h[=lHc$xVW\.#,>z]mQ ʬl2dF뛍Jq0*[[#G]qM#$'#-xD֨'sjnF{A:3ctS?vD܋bNn. m:u壞$Xy u]  ,П%I}KY`{N-N͈}vSѶxt:^/P}tHYaˈq ~aҶ书>K!,z7Jݻ|~CYW{Co~l*WQGOը~OW[&ֵ+Sݹ)y?fwi7ǒIO/vS'uYhSxog۴6uN6m-p/P%~'v ޺/]0}?Vt.%'$OB\"g:x nX+jdSXhNFQ;%U')&ڳpOria(M,*+!:nXou{NgM_M#U]l nzrb՛WkEFH16]cRqu͗hW٨wMpEƺxϏyM͇jrܨ;t^rMtOeԵՃzkK||m4X* f'l;{˜++m;ۇUR]݋p]S)F|Jw8}.i94D|aA3[Rff,y0_Jr 5tArnsm{#-Is|    ҟ@@@[sO'oXcpY-\*Ҿ濒ePWO$rkO'u륷Y%a|<Ϧ'FOmvZxZ8h@ꒋYazCv>^g[io-B^Z%[MsTgw%]˫\3c Jr4vt?ig/bjP޾Uկvksbl?Zu7I."JX߻u|JJŧ]H-'kr#߷QGw.Z۰o)jVmE]雭lWOfkF4-}{>)|p;d)fOn}/Xu# . h$^ZxnNZx~GWi5sbhⷲm+Ҿpb-qk[Ӫu咬qק-S\,41ܮ-rO6j괦Kyq|χby?]֗+pcwUq]ةVjWjEX>*+op~8-Ζy:X]>wŇ3ЁckxE7e6;N:ķsu5}tx;lmORF>{Dlծzӧ՟?^lVy :ݎ._23UX׎FOKΫi{ 4،;yDt\w^Q*+6XwnfZٵKc_󣑽lX<%wUWąl1u?ix?^\t- lz4;1.,ld=y.3W)ݥsknkR@\o\VZsew93y3^CP4טb>r~$GBQ+#:zoܓwV24vv!خJ+F'{z0.CF\z˂o~W/ ǽux9l G`p떑KRiNK.:opw]-Qnǥa-Nմ1Ǚm}tWʱ' Yw*ƤxwZM.X,gk4yK.x8;/<,jʦ(Z<"F- $S&jk){q_?sZw]uN,99{+\r~ux"-|v3{5Zu#SFoU6H`nk\cme' sZWEf5ڒO-&vyi'cf}tEt|F{iU7,ski?SFio{B<@]]]{FJ/\؛CZsGyW|;[=.ίֿZƆ<n'TD)}Wk/Tø^Z=8/omz>& /+v6D[͋a$4Qz9IpsBq o]O!睋 sGzyt=~ٱfj7m=w⓾.L%mKsRR)ܗ҆4\]xSHhc`p`/q+(Mܻ_A @㠺F<Ƨ4[5?P|OPgdM{NOE]i)<0C{ obwqߴ71[foW{> 씏g][3~O ( $o$HZփ%χa}J5L@~w{2V;G-c5B;yƞ_HG28Wsݕ<}}mj;ƌuDgY³&qԽG8'J9z=.ZMw71ǢxPӊQVռk1yq&ٕ'J4>}r:~;l/Y{3:U2h]~Zl@eJ1\q,aqxk[Ej:^. #II7{-/nfdz|ms]v]"b=Ih,zR;sZ0J 3A+mR͸^;;Y_/j}IhznyZZ@6[.hkۍkФsfI_?R5;*Q9Agr',YH`4kN-ܺ.̡){QsRыPZr~?CI`7\|<*fǷ5lI[l:lzdG!ʜp31ZjZJgK#3.ҕf!tWjj9$hqC<    ӟ@@@^\36/Ta! Tn͂aݝݤZJv[61?tЋyV_͜aV>2֎'=2{م1;g;e_W-;QN;߽,vn|ǑؾZK}#:@66ߩ*)%?"em~FK{y9N+WQjY0ln9n/JWJ=mX]YI=4>/e?0[? }'=oVzʪ^]et.*5 a-q\u.T|ϓ:(U~L^0nY޽ܮaxHMuwėQ7|vu*=[ԥkaۭil5ڻJԲ`̫s~Ju%Sm.Zտ?о&ƷvˇgkY4_hk ~Ypw\f[{=:z_>\N4o^U}w&JQKoYnkטNP-m_Р4cC 3V*ƲѯJ QK97̀yAjd}ݹvx*rZ?~'is]_4o͚;ƴ|>eeYK3pun7:\_7O%İTx.82|We(" <p۶uNlHvYM :4R.fةɼE; xX*暴Uj܏%wk{m]-jԫ(N[s-vCUG]t󓪉UwZ|Ub)|Ѱ_ׯ_5^w3vz?oNO0!H'kq*V;Zr7[MejY"7OW*a4[k<^Orݴ4qQ+po~G+dfCkMשZ;TJ.;O1esK=2ёdoe/i{o'rBa,s͝]Z+p4nӔ?mpqŖ}5V5Sjk\.K>TlM?g=vqn9-sk^CpsZ7U)u=W[4j)Znicc#:ELʕ.E3F7n«1,+4`}u:E)r}zE.{(KWѲ׺r^k]|)"9>K 6 RbNV\[-Վ0[(?9IyUIFKe_yb-i3Y `=r;kNK>ՑWvO]^)yI"sgkU%,Y\{Lm_WsJ}M[cy5*vG+Χ; ~aq)%twwq={8 |w3v~D>vߖl)_W-54@I6_lO%=Ռʔc}3#B*m^c۲J7nE=xWC8S5؋{Ψ=suȍVWk<li.KΥ$=(qݺ8V[Kݾ$ zqRl[6Dޢo[aalpQ,qϞt?eg}TI%m'9_**1jh0"av0c4._%.+1}/ShOاg(o[{:vL*jIْ`cHr;kKT|SZ״,e˳,躛;S7ˍZW˖\tA1MW Vo^ܥ[nkTVQ⪦pke_QT/|{ؓvMǯMqǨYY'1HTwe`m_EJ%=b3k&YO7>jފ\p}~鮎+ϯ0^;-n.    ԟ@@@_+#ڏNmm"ߑNOaۧ!Bbmr!b*!I;4ƟUӁ6UUhFW_]4.n} Oxk I$ֻ9&r˪k_}i{ZT4Gu('ebf3Dd˛ la6y)>><&^osJ6X4*{enilzf-gzsoEk(;;ımKN{ol\xtwjqodXދzͮ/Xkյs>6M:k/> h| JU!'IKX՛>#$k$pu\-:>zyS\uu|]}Ognt媋Y'XJ_rCAsZ5jm˝Rl'D8,"[3|\unwۅ6;[`h{h.u{4VZn6JzGr>e,) H͠6ۀMu|:IZ[ҏynz䞎^e'`㭏yR7\Ĩt]YsOgM%nW\m5ٌioeU,}77.ϐU)MFJ2Zk3[Im3ލDo~XV|k+B|uML9o1ګWVzȶ7W\2wC$tB-vߟ,ŌUq uc\ aYR [ġ*5gs).车8F23#ڧE44`6W.GM|H-ڋI'ɫd'F:ʝ{w~weq[GyHy^sеè]w3Te?vx>LR0=Q%(o6:r}]>ۘnk\M#[P~+WB˽ʣa4XjiXAc*MWfGn5nGˏoB`[_(}o:gpljZ/ن{g}\'9Z7W+;ٿ<-۞gD+*{([ Wvq 7µٷp˺vIjR>`ks]ֆRe I_tߞ$WIgaQǃ4M`Yյc%ª{~Y5^}' RSymˍK<%_}{YK+-ge U"X}|O6IF˄iTړI;RF"Fys\r8m#!VMSKF|(QA^.$yxW-SKպف8nd$ZJ5v ? sMݾI2I0or=ZB oe M'pF$dv:ٝSa#[ q~[.ۮJ(QY-03㰌mn⨫ۻWϜuR5 =ċˀk%؉QxTy2>%v("F6Ǟa#O85s/6;£4Oqf;ٶWNgq`iьѠf7ﰪ=u~[h)o[0j=i}ՒƥDe˕h,HktV' ]/Y4p^6-W5tyؼd~$סv8TpJht毋YXE,T7̊Sl7NnMwsicK==I}`Q@q0x͇ᲇ@.hE(ww̅8n>~'Wv*k6IZSjr|UݴV:/CxVn}敷 ?T*ڏ7{u";yy/L=J)9*?A] IG17٠/ggKr+՘T?#s!J`]˷}yz3A!!)[xmiNWKglZ6Xpࠤӎ;Q pIbIrIm\ԋRV׏ 3=lr;W=RQ(S݅m}3;jf4Xsij#44я[CcUNU㞤Æ|OIGvlhWDc4vIt.)8d ܷ6dk#us.meO|I_E#Cdj׻u쵇h1`tS M}/}{H(ۺ2[;qs fv/]~ߘWZ\>~^KMeX~K;+hv /Fy.~~zsw*{yu`UV??pyd^l-=dFwR>7hC}Ee VMF߹VW7tTTt (hcƋ6w*לF&mۻmެ@t@@@@՟@@@½#pt8gI\~j\c1)>i45#4=֛O>+b0x,[,N-p>D,a[Bt6i=N*P|w$W볳mWN]x.I`m $oW)u8aX'LspʷOGipE\(V׸ -lή]|Ϸ4ʚy:䫿n'KxZ8M!QO|v tdĹnj߼& ڀt@[tZiRO+e[T佤^7_<[=^lVS;䣪6En`XEo.=\.hE}JV',i~6g]R:.i]D2_J^fr^GglVGKؒu.{Tos)ˤv5ϔ푴.vئ'Q]ͶKfTao<…zk/񐽮 hi.+)p-sT>,$~^M=y`R?DqYbtꛟEv(7+jjwhkH%B[dg-mv}]Q`]5ƒe-m{VEϱT.>/R >}o_R4){OӬSoh2mp/r. *M:e+u<v>]/ ªMŸKy&vm+'`4"&<2-kgMY:1P]gVJZ:tJfߺ{(bfViapm][ټhPKソnfW{ыM]kkupX˳_gX>p=]QT%mՕ۵NW?$s2VqTYE>SmitVk*:i cFR x{YuMr8R mЕ]KW굷t"6$f~ x.餵wGKh[Wf]6(QWG>4D}[j$C!;G]QW|}`B(Fn;եv-T+ hs"7;G9^Brz#]ASJɵ9V޶Wg)5_mFg{{h.κ_,ĹIeKωѳJwj-oJ־S+V:cDtu=ti T閭zV. oouX{-w𹐂v:zKA迦5'^+J;EZu\'ENFž7ki\MHf2Feup[\>מ~nyoIz#;eXQ-*%Nu)׌a&-NrVn[GA%4r;19HXoRīn=oglOn)]$7ռ2* ck`l O~XNdqn>:I5cC]bnm}tZ8]gMoYſ܎|Vg|6# {V_]6bz%Y+,U펢NI\{{4bYPװnt7FNw 7:J;5(<꼻p53/PGdU0G0R {dzTD/vkTԴ};+cX !؋k'OVR[ߏVI~z5]=WY\%'~S QV~,,~#vZߗ[.|+ÕA]KACN稑m̒7_J=!DVJ1eD|'Gjpg{@F4sȸwM:a$"'nOUݗko`K @@@@֟@@@"|})8Ύ\^eov:͆=KqF9D7>WSj?jƜߴ;M[!cySҟԷM魕U3v+!e1 ӿ˶N+%M-b\ȬMy4o,y;+r*G7u3ϗVAhM7Z:dz;>ohnwyHok6|[=m eeh6[osԤV(~=Mrrx\[z&ue[K[#c2Wwm;O]ꤶ}[NVK-ݶ^jh#6f볋⫫l/ tVΥZo\%XVVKy`h- f7slNij-,,OkNTi':q&ݒPI8e]M %Мc ^C9(Tvxm-; h_tGQiKu=ŭa*G:7ם9Ec^΅͹ei~[H쳅H]nIi7|ɍ{<%*~ܗY'n{Ob'kygĵE - Lgi7ռK{׽.K9t3T-C}ulSk븕#XSdTXC+XQ1ϋ-MET12̏ua_oOV_eOno >Dٶ-Ԩ"zW}h3 ksԆiu'EEф9]KH>+bϹ{xPS]t `5”^I+mԍƴ049O-ρTǴ.Ghtܕ[mzq]]85u sZwVN}4N{MJQzongS 3$yKm͵ 8M n3ޜaj-{Qc+ilpK͆SUW7oSe#$+OfrSP5Ɩ{˜nӫ6hEt#o^Y6SQKvQF򽝯)7թ[-MFyh_oR,p=Kt}ƳN{Qcka9#9kÝ{HYJr:J GjJrHQqou^ɻ6.'0Sg v]ǟN\=u]t^{ki{ Ff⧓k;.qiRd9|hm=h&_ŗ+]%dbx^IA.$9aWgvV;\EF%$zZ[R]L^JKKI{@- yUe5{ZIؔ䕵[~N4v߻ W|](S^ʔUw]@,d $魶 oqY{E-]sQYA3D\H]a/*5xVӥ즯J07.f3fju߯w{2M޴w$^;9:<;/=o5ZwUNݵ' F>O}uҴl;C#l;`eFլtM6ݳԸq8n:ӻWx7{#7sXi1N_3"weu ;\y=[z1 rIF1ye|95?5}t4r^Zhr塛IM׌ Y_xh.cktn]w且ڦoQɥ|Wi͇f3&'QSGc28鮍+6P痯Uϸ}Ike~Z>\ڙj];>B9GzUwv-E'VrROY8NBd$#u@`ISV]>)zV;FꪪОk⵾ mU覓2>7gs;h>)j; i>+|ʍ>UWKy4fVJy t.l|v{{U{×6>ZTĜ_K6I+o*+)j{]p`ohEr;֭;;u= QKf-m+{ 5nk1\14NhqᮣpG#~Et,Ȯlv+U:SN2b=e3 .p~MOZHOL=7RYvO:yC3}mz*_p*߅yqOc8V TAS>b^94ۦpwe~x.C҉UTZq^c}qK"r|*     ן@@@wsoޫ#!:[rWtMUMEtYZJ.{q }YѬҚ*J:h z4f8+.8,%Dя=iVak#*p"-"#U^ţgc~etjw^(>R wle=>hu1u.ʧ3iXq[U+V*,~ u +|]PwmÏ^EWL7ls6{Kr]j\Mi>|co9;*RnM hQ7mGMY&CxGN[D60uhV#9><9yܴO;&-N\#)\TZQ2ƃn7禃⹄__y9k?#Ɵ ^K)?9m`I|yWT^ S0M_dc+cZZkhwԟw[kqt{*Xrw'n֑CQ2as Ru.:ˮ|9r~sg6FR܍*NYxYvXQ #|ٚĎs{Zր\6UK.༬.~P[[{J-)NJoI]mKMM,f2BAnU*=·|= KPj\UXr| $1[[ۯ۟;ۺV.?􅤥%S啎oSѬ{K߹ݯC{һP^o+#pF q+c9cH!f(ն9_^6z7Et`_^[TdijمL[/$1Pe[O F"g#fO/6ն,ŸQ0';\Vv+*h=]F^t4wx8ZF=Y`j-Wvt0m~v/gRٺR>(\B7{sEl2M'mURp_u.{|c,@z!@0F)Gռ2R9{x(LMt"B;R2d9nv ,YcSκS\pϺSMdӺۡ)6w-V'vⷌ!lmoƂ,yNXo׻Oɧ{&I2 }J_Q_0nΥ(.Z7rǕҶ͓!4O`7e|v9*~\Kd]58˂m]TGY }D@ .^ӥ8>hai;-+wWowev.`!7UT8AG&CeN+5tN-"&NOjPu1 j^/{ZnԨdf)AM[w?WHR4 g7qwn>lq--{K7jKT.efx\׭cF){#6cZw8aqhnC-{4m |C5';<U3RzN#!GQrX SqtFO=nJ5u>k֐k:xyϮ>~:غRJCjƵث]+YX{`@u6C{[9->TUUiXwxsiMӑaouBu=mfM+7Çtל\?XY{V|ňS>R2Lx\UEg V~*2[|ޘ/*{XޥM)'rv޼+,<4ݩkvgVf;a|mfr];b^~Oh't[ߥ%5v;i+٘]g0HHˋ;dz*mLf-{BM]<kЪqU5M練 TwZͬr\@xxU}})(RYiwM>     П@@@@1#\]p*:bfcQ<˗xġ*)m;~h 5.S38 d'II{; ks-BAt'_GFcd^\N]vJjI 2C㕎@Fk#ܫ7u=ߣj:Sz2RQm7cSXLHc 7 +>AkAuwiex+C6PyYzq{T=,L נS0ev9@F4>t)d.ır5"w`3 u{۫DdiJ{ZN:=f|hۣnCMn[A(]ĹiWN*{զ~zc|KSN15-{ j.Ԓ|]j=pۊm^eT{WyAmO*TjWУB8,F)GH/`wvolI<a\vv-jճzɝTfٴTGJMsdNMO8ةNIٸ&Ju)d*Ugڌb.{SzoL*_\!p$MV*Ow]{?#^S-4mX4*ia-Uˮ Aa0+IwyGW -vjo>o=$LQ/x[sטߞ+-2T_S(cg%}#L-,V٪mdia2.h9v]z+/)_gl{kzRg~ (2O%=Am4rPD;pyYPiWU}ibelJR' )Fq(&idq\EFTFѼ'@t/f]V|]>\uޟQZK^W7٦>>ץKmim)FXKhVX(i%)E,hD"%;r˘ruf\ԓʺ:}OjNvs\ZƥnG5nhpHI$Is[3e^2SRڧ2ƀXP߶8k\J9}S{kz2N k#4kwv}Cʧm> 's&OY^;+z˄/1.u1kH?K=X;Oƚ|eH~YfuSӅ8$2?,68\6kv.N:)˳kRܕ54s؝ ]84\(aroVcEfyȨsZjUe+a%8|~w? JsVһl^^ݕ?./ך:Հ: Z~ 6pj\~eՂhmTjn3ZJ)Z.?_w$D֢wYpu=7W4]gZ?I܄ouh7ϰ}{~`}~W1%=m+uKTyM$i[G{_M`٨7h j~_"=S#" x7!mH.S+lC4qKmkˑUbFʝ5J zcVuw*GEklHsۧs~+/;$Y~Z{Z%MZbgܸ11i>@_' 6ԩKI'Rg7t:ݗce@JZF@0FesoqmG(e\_m/^\}4X %;0Zg<Fکa+׳Eס]NkvrV+]ll[ѷ%fBiSJG-x_ р -ܲ·c{Cql^x2ǐ]o%J= [7dn&buM >4*n[RA^w-s(s#eE(!њޖ=R~-dt֏߃ኸcTqjFo)FXU轪;ǝk]zGn[σ6)>uShٞZ[6k89<޴8QQs/}tF kvnO9}>+gdRzͯzK3bӳ$=7; +gh V,Qrml%I4.u,m܏>%ym Z.+ipv\0iuD-ng<:mM;7IkڣIcǒ^~Tzz0819J| >B,7 ]ֳJv*/h3{Z WB kf7µtҜ |.OO"6 5` k@][X֔mmvU@@@@@џ@@@@@ S.i1@ǹfoŮuqOS#}[*NK;5mV*Fo˚CrKw4~1t( ҝ8mZݝt]Cıj9]sX{hphI,'Qo,w3[`.m TfSVI|J(I:IQVWsJd?FӺ$׌nY1c6&!dIz=7=,X~u.5ܭGR1 :Kں=6np ]|slj~/m7= Rۛݽbܭi2_ֿn9M7Rqw2●Yz?4sCEwj~UJMcwmxBǛ vX8}^o.z'ʓgض2|yq%ԩ }Bk'9hUx̜C_A3*(FjI$Xnʎr;-')аm^QTBsw]G`ؗ,jkss׺F GJji[;۹g/L=mtN3pݷ}򴞼>8 Zr4y!\NI߯*ul){O܊\!˙iBְl7mRU}Z(6V]MZ4!{kt m랲Wok-Դ[3SF^t*#枼+_mKe)NҦݯOBj] bm[ ne=xN NOYEGGWH%+s9l|ܭbO\ضNFpԲ@&NeQYvRfga)Տ쩶ZbVnl5(0|'ݎԫomqQOV)j%_NyGҩ-ʒzusN^t4NX\l/`]PohXʼr* huck;fm򃽺84K3EUeMһ`:QKhm&S-]2νk2ek_#ZOp7AWkQ,N\Ujd7GC50!W!gZ{NMpA{nw'`궾ha_njևZ,6m8)Ht\sc8֓NVN)Fvrc=S>ׅA$H,ȫK8;IY$=(mqhgn"TN֒(J1 ~&i1+d%=CK&P daЂpe%#m6:JRJqetYM5获d2=Ew2Xymke=bǙ?О#wwV_Zm튗3]{vIPj֛ԦEn]C\}ik.qssېYX_<ӥ_}Dݕ^ݷ3֠8^˘Ybu{'m9y"1, `oqm;vV[l~Ah4yr]$s,)^/^ħ}88:+^4VgI^-ղQG6V M@^vi]UwVV40[RkۧiVM?K:a@$k8NSNEU/v72ޕ? [@,I~#!窖ni6[kGLQ挖1p>d/ᥕ'x9 yTRJuEE?H2:ZwQ2֗KM{1xMe7Ϗ%=L45eev7u\7Gez3%FZݭS*ɯf\f X3k\v2NީIKz+M׽{t'o(bP? -XYZZOi[GBSIɿbVs3J==`WjAڤhf.OVed hJfᑈ_ 6hЍFOvGl{GPWM;4jRrwyl^7xIiAkv1 Ͻ@TiRM_.Ck+Օ𾇺}}tǧVKvVͮ*\lrw=l2u9C)Kֻ}VB/kN~= <_n붺+,Ѱ@G>YƮmhi ݞ _{M;YU[VZzm3ZVbBǶJMݗ$\Z>[mje;w-|_tRe%;oKzMYu+G}zwеjSUaWqΝpRVvEd>ii-Ͱoob]TLew3SwWQMDwau,􎎱@&@B֓UgrA _1gLeHcp\xjݻ&e/Xԕߪmun_/0|BFFIٗuhO+sjKTXT#Z-^Ezn#1mnTyp>*ݶfؐrkܛuma8֋xi4~*Cu;Z*iաf+f"krII_2x^tR7)nbhciVU8? 9v#؝I:w'۱4y!{c:FZ΢ygd/ ]8Og#RQy)MMf/ؖ9\p2t*Ѽ}6VtO~NMeiqk}7=`T& O1hTJ~t#>.V5ӝ7[h+o1\kwm`Ɂ@@@@@ҟ@@@@@ #jn*c66FNRv龀zzizn6uk5xB.)YA4% ޔi}!Եsq u549)i&}-; d}q$& 2qͤzm"׏|[U?e. 'MS /7qk}wIE?圪ɷsޏэݍoz<+gN148m7|4k}r^ڽ[簧s_([m"ZY:ߪ]Za MhԀI̸Ke],rh<TG{ 6鲣j5vYNcxe.\#á%{a}M:rUVV+To (tVq.ǹ s*oRT&[o>=y;/t&iwUo:M_:DVu>Q9*XV/HgB-~9)–[Qwr'l)1j̳^2fv '*xyWHۀ6 (wwX+*FYMkXq@͙8;+ĭ/Z ]u3,#s;26Q}sPw8wiqz٬ήmHSak<S:܍;FĞR} 9(UtR|ƻ~)ӥSmnԂrB>6ĕJX}C #cE"Vw=*Uc>&ڹ5Sg|{.%Hk`S i%6kdp7^ýf5zneE 1%{:V 충RE?o9B/5IyE&wUͅa6FAp]n]a[o",ExӋfq$iƻYJpy7VW~2ba-ZXŲSа?Dh]gO};2=V9œ+g7o=uoͻPpf-" HaiV=}h{?LoG/ҷU=>NrS.H#<|BR+wTయӏa6H\FMōt]; 4(MڔJ)-+6/H#cug%M+Ky;{a@ndY\/uvGn+8T)t=Sa6hU[6GDbYZu|<5dbIϭVxOڔ^KZߖ;J 쀏CjR9b6ʊy7jszɏaxU+'QmA}U84_yѫFKrPNNXvj|+ҾWMWNi9RipN/{T dzPhp>x)|j!G6 . !WqU&U6ʹZh}(l{6e-fI;aEIeۖ1y)R/PYR4:`M9F /jM(YRQovI4W1!ݳ%~Z37 ŪkTM%ukw J%g'7ǻ]QgGtZqa SJ(.*R9nԔ(IЏn!cچZp[ ?ːGi a6~?3'{um)K*6~}E{F9FW:jo%:RJ*޼IOUZW@lv*{3{nƵ^/¡5xcnXl@]Vi$VIA^n*ˏRZ(|:jCVCgesw˼aW ز銑8Y嬫kXyq{1-O޵YEc~f¹)il׾SonՆ:zL6T}ƜWRVE}eFF:͏iB哫nbYw5`,-Ul7EU''N7Z;#zJYv& Jri]nQK[F3SxGvsk-scv6IzS*{-T`ԣ8qr쮵NZF~OCS4T׹ӵ7?zaaY#zEhיiORWH.<۱iRo. ~38IQQ3K3&܆$]+zC~ӕJ+v). gmޭ9d@@@@@ӟ@@@@~/,  E֧Ҹbl7q %rRޏ5BMErzIjҷb^1{S3cob5i*4cTrO@lW+ZsszZUj8O&[éW~8i-\=f%?r/v XkmU#|IzEV )uih>[fB1pi6MƤUrɬ~YMEޝz,S௧ {ekc9{J 7*;{WXKn&լㅞ~Ғ*8J)QW-`WoIݯ~ q>RӗD㦢\&+gǘU:*I7-1Qvׂ2d|f漢[*k|H؜9-WO1'՞5qTC!w1as#.so׶uKgEGG{}ZvJ [0B?q]%fYsZ+W<ihpnpܹB:ٮ#g8Eqe}Gr[aqp}krO{m^)+M.|s[;dE:7+6.8՛xRFT)]FMb~}0:w@#V[[m}4Џ3RV[\v6ڏxۿnR渗4u6|۷Os.rIEy"xDK?֌[7[/bS9[Kڄַypxo}|Ewv޸˨2wWx|y4^٘m]W~uMUNm;4>gXKܶ\B59.ỮOC(ږe lG+M[+wL߅+w<o0#VO g}| G>ΫZzA/q>uF6knTÜ9jiYhfUa* u".+M(| t\E(!H1(:C-寏gd\U5Fy'BJQ[i4WMe3mUd+Yfi$lụ܍34nW3wgc$Ytܦ wN$хG]ϥk 2Hƺ'-pд=vWіiFkЕ 8M8-Qqvifxi8rXAZyq+(NW\S8U{ˇgTiHWĜ1ƕ䧬eJ.ƈa 1]$e6YGh[촲|Sg S)oq&=F˾vΌ)s vzzTG^2ҜpK71>x D1 P)n6Ro巂[`vͯF'hH:qPafլ>=(YWpuzoټaM]_Xid֓H ԌHثrC2bhB0~^ͧ\X^-{*~ps{ NM|94Zغ_SmGl,߸8c8_.𵎭ٙ*;p /Pyxs\rM,x7,3F:8$I8U_#{tTX0{+qv";cTYNc-yӜj$ &fǑEBȟ !ymux ~G3vui¨83I6jS SN-lӒ[Mv~qvBG!t啥u׮ Htj)?y8;{Xoj+ip<#bn=$5(k־b'jMw#sZ׾5]%USWz7ytʛM/{|'[/_*nQ ԤeE88B 6T}Rx/nAY67UkL+&h6!S̕wg#6}; RVڴ5^m})BJR=2+6ܝ۶{ &ﲫ160+49ث| c=,L]$;TYJA;ԫJRވlsVʼn_@t,B0gRXcͿ葀O w+ޡioѧy7NEgI4-_Eu~eteЕuUtrzk;ײwٛq|Y2>( .ѭZS² яijWzj|`11)2;H|\… YH8Г_h،U,dN*EF$I9}gڶCMMjxtl.\#1b@7.a 6I>|n+'yˌu\/N+D)8vӚځ}[ ;9$xV޼QGB~TڥѧVMNdBWsoMltYJy1nI荋.X,Z(ge q[*#h[DK?q #i%3 3f_clS+'yFy_zScn^RRoyFRR³tJӕ&]KsKUr 눾G62%WݲoM ww܏>JjqR,*ힵ+[ }d~T^,U{i4F*WM˝Y|V2#Ǽ\ฺ 'YΦnÏ/Q+|1=ۛt|O<~jIFVNorGxk ^^F˖Tƅ=kR֗9o]p<>ᴰ{=^[MΏ6٥(oμ{ f81Yg;-t76&Q \EۅWjn?j8-dºo ھ;8@x(̽^@g#/cy {|ȫ'}҅n"Roy(J*G݌gQ83lnycp6yYs*M+\ҕ*Vu]c|{mhA x_oԒݧyF6ԥ8eѠe2L2w{DHlG[0ov˰.H8ro.RobF\=i8Twn'416@;l=qcW"ے9vQmX:OǼ[}g@.]/}pqe)d}o[yr].zmՎe.m{}}7Xk\ r9m&`U   $enHme~ McvBrJ3-ط-4MZ?STP=TNŒ xÑ*nyY9)l}=JJt%(.[/vnkp[vsq'Xm[iތ5QAtDf<>wtvZkN+OBӛ Jj7vs/(Ԋevk_4n?OKCa߇ц>в1y:27;uFRݟb4zJ:oѵ)bw]\F%S-]o[B:Ndե^؝۾#4B~鸘/M 2 _qTn酶\8ۢbK9* )T-&1O)*%2V,70o;{fphG[+kirG7FU8}#8! o{$SmӲݧYΊ'E/UHm0ڶYnT-=c%zxÃ_KF1m#;{z^I/=ljB`i%ukڿ^llAVX$O2x6ovNm/W;ϱfCm! ΦŐRmn'NQΉ 0 uo'{mV/)u@.b/G_I6Lqm|]ܝPU\}ޮu6y ܀Ti>wNle5A\RZU/|q=hu8/:&7Uҷ g@*RbPڤ9>ro?{#xBKy"JiD޺JOU6x?pD0e=4A:):Y?;CgNE-<,6\W< a3dtq0]γAl֍vB⶗<.*skYޙjsnaúf6?6t!l5!U-j䥸=ǹ&eRr5>(i}[ԜoM4.E1뽎~Uk'b$[lD /IM{Aò27$PnRy#j>ekGۇ{cvꖋkv$ތvŎc^*H+Xh֖@tmƠ w]}:iR[5X]ii߯?.jóO>~>ζ Q{T"K5RjXKb?}{I;Ge)ZKk1&m7GRBWcq3ߺJMFPxJ|<k;i:\{ we,~n!9bnU ^Sn:>dWSW]?Y ,5T3K?_&ٝEkws_rteحkbj^?JRA攒t~ Kǥ~$b?}M]DNa3i j`m̅iE>T7?e<7[CMU~ܔ"dd|qASDe1ͅ =76/u:OY&OzgJTz6>SEڥ0J\7\cEԍ8iE ks>q*Ww2km,UZWc8X{"MSc4NfHnMF~{\\YR} }Yú+(չ{(yUDaEM,"kH*Vj9JO|@s')sN|Nēr|]䎑);[)',Ovwzs͕-Kwar%xO~_om-Nm9ʇsTN*YmbئƴC$M6cm Ѝnt=-V5:m4ivi7GCxsYxsK3~}9ǫ6'Pui]Gw~v5:W{ϺͿH]ܝգz7{'[pVRUaacI|~h'BkU쪣7|8_ΗGѬu>輦?k?fХlhQ۪su"PQJRQX{[諊MO%1^EF[ZQ%#V]'ݴ\4kGziM{.NTRZIS5u%fM3z1<v"%31Թ Ăۛv[08{JػK]e:T)B]3]Ld/GCTv:QROޅ(S^bݚL?ĞO+Q0Bs ZkA[1sp/|=w2˾.w1*r r/WroV>G`mʭRI&ZЌ$(EB}6i7OTUt?0;A~+ضMAklL]oQow&c5sa5l│e}0ΨJ[}>+s̞ίϔzU9tntT*G{1|&^kφtٗ;|gh/պBFM|-_ai|}Hq$HE^..=}ku$Ki:D)tb=gpèZ+mp|MFN؅mrnok09]]sOxz*]m}]mmbi_3꩏={[غ_)~ sqݯYFɷ$Wᵌ;m{r`ҫ%lc$ Xt(7's}oekTI4&,g>4t8(V"6{}K[|UX7O_QacxB*ͧFeJ4w#%goeִw?Bt_MƄzOfҡlΝHŶNPݯWVܠgռ(]f5lh wNLNi_)|N'֩@=_MlCft%6I ʔߪ]ҺMmuynGI_eɱF^Zpb^޵[YIEiu ㆽ2 )5tw-Q7wvnĿkz?f1VH=&=#TNN]hR87 v76ŵoynL.4|mK\gzgckNץu"݌Bi[e)iڟCמQJ ɂ| &+-ܴ%m-8bM3\;]r uyj?c$i6$re̬/zOgMfVփěEMെ⬓{|XN߽哩tjmdpQVIuhnp^ª2k"p,\ @nsm佨ؿ[t)Gr[vqNtwc]+EFѨMA)6֡'NukWzC.<⌻ ;x;rd[y:y_jN;R>Ǹ@FދqƷHm\\6hA* s<KgO+֯nڐ={:Y¾FӺF?ea/а>  ʮe5OF贸?1:Ǚ6h?+/*M%GaoGVt7> M- pG(cg _]ƞ) MErO,Nqpu6;B1QPpogś1n.$]8x:S>'nlIp'[~uĭFF~NTw9t:W9N2{.0N89cs\}߽<\|'CF# ~):YjekM߻ /I{JӼ3GƸk 8HVFt l\8NyavحD-E٪vٯVٔ>7[ ,e*fWxDMQ&S| ]P_̐%6x5rW瘩t_/q--mT~dTcEJƞ9M&._SE'Lj6 $k,*9g/cSsLF/8zA"r].",vRk~ xLEɩ?}Bexp$Y+zKzrg:J;ֱW촑o|mIsjUq3{vΫMTyRdjN{-fRqK0;L\;=1?3&~N$h7ڢ]3n֒R_gcU;Z 0 Ky'&tw"=WzSx[ݓ#|>5GӇՒ=vݘ<ܛ`U*T$ZM|NSݓihѐI?6*EIFP(ҪYTN7riev6–:ٚ8Ȑ7+ [ݟm89Bx]k~4H><+y-]:y_iXXƨykc'@H-ڕZYgBDRriָbOCDGX ?(Ca~ jlZ'eWLvzT_g)A,M6GԁaVRW-dh}k[gܣ9k63klkmc{eQjV;leQ^[[ c3vfB|"Uմ*.2i`1Z'S4vj|̮cto9{([TfߒD) %dtV SH/9b ԉƿxoUsd}.lb*UJo|쉨] 0@@@@@@@џ@@@@^.#tM~WW3O6<V)vG}tg$.O6BuuiqY,ˆ<%L:v6u(_/w={9=W6+XPޖ.~ xYɔ8<\yd9r{g}?bZr}]iIxtzNjRWŨSO݃c f:J7sW*I\*[&\g\QomӒ*؛:vӼjWMF'XG3q[n?Ap cZじ3~[b7hYv_쮼Og] ]Km]KM=/͋o,YyEmïA7%&ʕ(Brܞ׷m-Z6Fc#no媼 K='uը]Rfw&s~qQ;_ ڥm)G[Bk:iuf6aU9#!&ߛOԍˈolrwAUdQ?<룉'h6a}ќVSTa;6ٶiKu͡]ӽ<ꂧ\kSIE%E}=Rᕷ7k. #^.J~'H.=NjS۪l BN56u )S{F-fiZ'|%{ gjߒO"{m(ASJ1bn;˻s}wqv=~ hs6gI܀T;35I:&):zv>0DUF\彯l_~O+uu*'za]7ft?V+2!wHd;F6To aЗ\oغZ7} 9l/̮V^l"r¦*1߅y%cfrKru}d {=d=WX9w:R>G9eқ-]6~[[ u1G3?c#CmX4հW.      ҟ@@@@?_zO xmSk7QKME6Z>Nzwn)×)9ZJ\_#{YebCyv v]wl.8]c%T-N.-k aGck?kكxHk+s>|Ê.įSEG5;>g.nQZ{e+O(ce~uճШ^l]#-1zÓ1Qi_uRO{CDPy$$ʫ٤n~NQ\7fBތ˘.x\[Gi/:{XՓߗsq"u_2R8Z[v?"s,Z^ GvhuT7e.l6Rֱ{Կy 6q gm2]A{:j773jLk״f饮C{^V5wӿs<蚙y(Ys ,N3~6%t5^ONNv䬾SQJ +^Œ_Ӫr5W7=KV`&4^@@+=J-dnx37K4 hd^m6s츓·E8`m.GM TחX lO/,nzmfkJZAԇndr]F6RU^$#c{'n:˼ V$У.Etg8]ltcvKuE+f̝n #嫼w^XFj=f$vҹ&unh&R1Uf3\CE`Ѭ6towaT=M&dϟ7߫Z$'se:%wm KsCeBV1FFj:&C[I-d|T'bUWٷ/_wg#ͨ׆4Mٻ%M|ZlIsAnSG#``Fdx;)q1js>2/+_Uzl[D\eVnSj4JXx!K9[#o{櫧#}Vou/ɮ^Q70.\o}nq5LQiQ\y*og"u(j>gYhfwz/Ehqaq;,]xTMإi;%>A7`OB:FO+'Rw:)j s]S{mTkwhO`pwMsE]9>&5M|.JvaVf&qfѯi.%<>Vs:*)g}<}KiՓY\uDcvv̓gf◛;*˻bZ/ w"\ٿ{/ȯ |tdw=2#&7S>X%ݥr|7+%}l.ϼw)f띮.28n]·m+AѝSu8v}ǏgaY[gIF9>ފ]wjvˮqk~e n]VWԿ4@sr Xӎ(,hwn`#.cCy!VTY0|I*.SNرmpY$[7H){1iy'}LZS t5SkK֋ƅNp:7߁i4x\vq*GH;. J7 WSV$25eys NOV'tGbh.Ѝ!cJ"e(> px5TQb@~ˇk*~~&N=hŶmGuJoksލZH࿉1k}4kmVepGKuI*gϝޯr/zfFXk_i*ZugQ]X7-;`>՘l}ȁ0>qssAN]Iq.!wtm>=Xbt}I*RKܓYҋRdAWc5UtM#+ݩ.vd`\z#z#u(Q”#+%쫮^ȚˆS꼤ޥ7/.ϸ7ps.hXUiiZڕ|Ꞙ;8tjO6g/ti^Gg"޽h) {蛱&IF˛PAYwQ췎 澷m>~|JV-m}.]c#]̹o\'r;W'S 0n %vZ֒%+߄e`yy~^}J$<]YnYނikmzF6G:Z*J8ʖQ#v i7KRK]:\/Kv|Em#\vApG̾{6cݮ=bҔzxoa*O3hw9Y֐yp4Pvi,aRm#ˋPǃAkNe%,|ZZgAꦁ{V~u>-b9Lkɰ:.VnFvhnzmݝ̍84#kֿwU#Tlqk՞{okq6U+M*5r[ pʗt}n٣{Cv8,*SLs˪wj6bⳅHL$Lu!X{q"Xuo/Ho`Erz|KMhS%^+ps2iؾFMAٿVMNVYϴUK_ d\0mp3QSݺnd:[k7ۯ_ț5I>ps譩-KX1Gm@{[qrh3f1ε-g yv껏 NPܶؐo(5hwR_<"ӹiu^Ӷ%FQFN`5\GxVXQ?9>fܺ661UÞuEM{'˅ 5wUwu]E77<3ص E*X'uchjdU$q6MjJj+)Cx*Kd΍ٕY9[Eu~(R ow_,yNƤ݊Rm 3$5:o ?-ViܾF>!Uޖ;:u9<@@@@@@՟@@@@<*_ 8h@⃚u^yfi+%瑇3p~F!%k8A1~Nz~EsneY%5mv\N>/POpd<ܰ-6YI^X׉qN cST=Zg(-&ܪ;٨٥8%gI+t,>'o+4>)!6_[gNqAs=atj7fw otDTڷyvx(Φ_yk8O.ͱ{W ˨ͬk5nQD]waS&H>%nnEdрq8g7:;p+E-tT13GHtwk$֥vdq< tqf 'ӊpc"sRF3.vx}^~'tgF)K^g{Ҏ 0Q;&Ӥz]G؆#!fXZm6\ݷDeU^zOtt%l+X,زM|%s'{YqZ3NOgxmYmu%Qe}/ Gζ&Ҋܓ 5?S>*=f6 aƶ'>&RswykmzRg%Vn՚ʹͼWG.,cW}DۍwRfKf#+eX롶=%{ ?SNW_7Y+kC^X3.ҾCŔ|l5~T]oLvxvWK&=]6w4IR56"w4R `sz;m0m}n&ꢾWPظ_sO:5Q֢k>);c|F܆I 5]a͹vZS-b`c:Kicu2;BZuͬnĞ[}U=۝:Kat*oT,7} h⩻إfpϧ\xX\oϛ}B,cKU"){}4r.z|Fõ$]u8o)z=F:QQ;vg8|ŸWɆ lyA.I6aӻx|+JwR|9n3ǣwd/hm*lӻJ!?jU%h{R524;qnC]f.wEH;aa[ٔbwfxݳ4lrG5FjǙCM5m7t8~=Li/ڹSnv}Y+z.n:ipry      ֟@@@@47_3諄j)d ī3SQHn|]s]Β6;?6QR&\QOL^(;Km=IcaZZ/a>XXJJv넒G60IQEZIwt1R1~ZSR}5ݦRJ; èX(swj׻^z̯KO1*+MKkڪԻb# SpߵsWM(p#4Щs. x(ossAc_ͮї2kE kRp\_#ђ_R?0詸l` \ne9-h峈M]|EjwS?fh ~b8|n/ŒhmqaR'/5Ƅcj%n(mk[vSȰwx#$7prs7U޲t_h/–m\d`o`XZtw#k]$?'Οvq_Nުbם}x9q#:ɱVfW p񭊓oISQ>bè=)a\h5CiDE-ƢԊ,zZl8vp$h#{$m9Iy_u9w|;u!~Q7 gNpkx<_j1sQ&GrCNQɣ8t$Y)-Ek";zM%%F g%O7vba 7?]TiW̙/ig>r|UV y;vD7ߪXkZoK"n<~z1O5ջݝdEX.8Nm߳-2rY+p<\'ui)﵌8pp:./]UiU6%G%IgV,.Y\X^F}YME4]쐼xӤ}Riwb2'X][, %G0'Ci>҅|IV6j1JN\U܄۶NNj=CMN US]=X+|c׏N9_IN[5It&X[%`"0B05)ҩ|}pPwoUEqogz*բySRes\\((%l=o|+(bkܟSh,`kt ]:8;.s˵T.\Vg?<{p84gӀQ.: FGRR$0%u \5]ytr^_;'ŰJ >)L吻+eX8Lnx^ҳ{3u}uvxږ*ntwNrSIE*)^jc> w96-$l/uQO}\Io3(] Vc^{'.K▅K5ioI=e?>%JQR$Svʅ/噧 DdkxIZO'*ӊ3=+ߋrm|lZ.kK'q(ST]kG k W+xF^ζI_C7t>-9r]b7f5t 󓃪x) t7AO˙UwE7Kg*GY_ NV:ɝw|O*ʗ19}.0 gu'.-uL66ojc jb\6˳X+hc,7#4]oLū :3*fm]]`[itnGl}9muTi&'d۵m;雄qN?xUT7%1p!4UJcy&_Y꾆],uv4ml=!ҽJJsUVT!(Q[n;"(ᇲXvEܵ^lb֫ͅܝI?{]*),pl @wyX:ƶuscӕ [C-veb{}:mFcF׿+.w;^:yirL9nsTC7(däi.NQh$4zAKUBha7rnqY[L%|.@ y԰kEe+զ7.`G]v:ڔva^(+PWv2X0 ;Wbeh<۸nܺd)n ǽF8oqRNHU)}}3TH˩܅      П@@@@ '׏kj(SP4ap s8˴s+#B8#aa}=a{uiJ)GX)\qY#8CPUWv,}g}#d7u {s~X6cBsuN.gB;e=+kNYch<;%9_ bMkZ뛋ۚrKqQ;%Ou5'EVl8}~+bG},^2Lkamw+۱Gt%MsX>Cn<{R 'ue3w,ٻp)(|~ňnS̪I.}PmƣBy-c7ce=IlQ 'Km| oio,l1ujEG[R\_Kn#qz 斗"aQSC{- 4"T^џʟǶtHl{BmgSJUg:֥iBN Wx4_PzHX{)&p$f` &K<*4ȥ&}׫_Ն춈SmF55*y~M،@hu,{ź޹ qTܬrsxx;Cs\rWuY?nk{I (FQcq΍J7]">kH_jtQ;(YgN`/UMVЮXI*%c@i6hɭmye9#Dz`RJhqeg5Lv߾F3n47QqKQVtEG6J#In* Z̒.$6\xjZ쥗ZZ4^&Pީϫη9|Č}z"M2{[;'jו+6dk ʦ:HI%}J畾?3=9R2*1w6ڬ+/cHHy.b9(Oy|r(֎{Eބͨ3¼&ζmǩ$ZxqWJ&_V}՛7؋kMV7@w|u\.Gb`w܄:t?X2j,nv9Qi csLkyex9[چ XǸ/e:ݘu 7'ꌥ "j䃣WHeilE^)x,O.rΖ>~ZXeUc,]Ke;~%cd*)Eksm>IQVk3?9*o۹sMI-hɶ:mSb/il|R~}Ա.^~$w8aC^ѦCӚȨ֥*iTOtRyQ~3爌ѺH;38IFQiy^*i090i@`з,fsݷ6[rO^>egYz7:YVZ[meVq {ܞ'lEbECF l ;[o^y8LNN+:N9+!H[GX[oe`қ~'xeJ&/e ՄX U[+Cw<a i佥-{c`HY^*M48M.="Ɛk6]"paR n99|Wmg]'>iv^龠,/\KP}JtZj|f 5ۚ0q%+ֹ܀> :VHm+G=}P+hӽI>ge}/:+aj6uŹE˛ќowoDcXߩ$nl8 81FC,3p|e.iڡԧ'(<^[. m{WC;6^FƇxfVfg:=֖XEFV3[nA[ԛ*Fj>$c{ypUI#@Rtq=8o&uš: $49 [uyM0 e?gQǵ-;ɐ _qg`'\;臽[kSՏCmZ!S- ~rJ6W)N6콭(ʉgxiˡ]Rs)8YӧR۱}y/=34.OvK1UPԵNV4UJ @`feRwg:26P߂V)($=7]+;k(+~OzZN;O (x@06lAǀ\ψLI3΍͒7>l%?HiVyKIR7[4_Ǧ)T◁4n,,$ kE|_zҖ]|sXbwOxrgi qC{juru)zk\}XmϞ 7~CqY(Kʙ@2H757r^7ʅ:d[xxW449rs~K +mM7b^R5F#\-˜I6 te$CgKԫ%k{oV\f1{x.c%3؆du3#A/xr 7;IqTr]s.h#UJOf2Ծ+m%\q{R<}˻{F܌ZMOb۷$vSd\i`nz ckӢvWEd|Cg\u@:ݰHFSrHppJIW<67iqtvs(Z}E|OsB֒Xk\eS ۋY}AcA/Z@/K#{!ZsifOyZVAlOP5~UpvFލ[:Rݻwvl;FS' .>s鮕ViNߔGQv\Öj~k\~'tk(=?k7N|9557g(tO0=9d= 3;d4$^Z~?b'oV˟Զzwʁ%txyZ]tm0z?*NXs+ѱQ}onm9c}NkW_%ϱu._o[W~f+i~=kkY+a]bШ08^罛Q8o~26.:x.·jKLGbesk)AJO)\f>ST ̵=sWvGRfɔ{uBr+PXS:im?uǥ;݂ 'E;cxʍ =0j"E0fγn僶 n{m mqZݿ3mW}Gs$nF'U)kM)7/@_RoHmN>?y^#{ClG7^qp/яz>q7fs'Ej+@@@@@@ӟ@@@@ RIS%IT~?W{:iK}u[vN4Wdc% v21&k2vYedbϻ[Z 3G[]s$އ9tZRm_RJ";H]`Oy*)a.\(R۬'Q_lxv3p{oکE}ՉkuR~ו-ߒ*ۙM3-uvOƼ>Y/~ӔkǛl[:$wUjGI?%~ĮnT?~L .GԹwsY"3rIwɛUVY]֥5Vɣ<+:󝮣pZ|WiG[o<4K'n)+\-gU: $K˜Z;'.R w~c˟qnGFQ={6Sr;),LH {ڊ,RPG蕹bNApw8lUC&(Tǰ勢|O ظN LiCSŧ{!릲x#M}'s.;nĝꕸTniS/cqͮS;i|.ˬǜ=[],b,O-/n=\J5שLҥnu_cļa46H )[Oܼ_mS˵/>QR*؅^vRVk̷ѯi~E x9}wt]RVv|J]5Tݴ2RIC$R΄AeR1GmӋ,Sގ3k<_7,mh)"d:xh6#(ݝx!Q,ϩgn^$}Hd_ä*׃ㆸ8^]+k fogժ$ 3Jy#qh'Cb@6{JLvSKNFt\_g|KJj 7@XR?N .жZu+8F+Kl3gh:7F6=/J*҃[6{\dq7U\SzeZV[Wz4PO.q<ɶR8%F%g5[OBKQ]"N^tGm3cWVqUWQ-l124)e?gqil&zl o12-uRQECt+; Ҽ5|.'-EVVO=Y8OEiABj̿OBh.5hU ,17kR5;o}dg5%dSg!7ԍ-\(8wx-+p}*A9._E9kŞ&ylo;TS# +Lwf{Ԯ^1 HnF[uMWS #0 { 6bM5;(9vM9%ϫ%C)I_[[_%ĽqIN4<;vz(%sn}"5tj",t;Our:eI;c%~v[ YR%D,,;_-zr9wYۘi4sk-}KKf8gKU1{{t)[C=Gy>K]1d2ttv\E)N-$۶햊I^ӣ[mm@]5~4H.t,% ִ <T8B[6DsUˍe(?,qk[qm7+w8Qo[FQ:1Ϧͺdr_F1JY.'Qjnr&ajq܊I[ s.\E .<_P4?vqQR&[gs#p"{6 WoSV!c8au{};\-7 \o]ӮrvUnEG8-ce"WCorR5&m?kk먦YpV.է3\Hע-NXOpe٫)aw~1 i̍_9Iz,$=6]#ݝ wvhtuXmhm_v̶ӵʭZy]92&l9ibs>t^:ыbtyeto~b;f kr|WFy0Q$~O/<MO) r<ecC'IXg\7lm u_ujWQ/WI.φK5A\Yn4K#ejpÅ^0Y[:' cs4WEzwfr*EK LIy;nTvwn vZKR0KݞY6eQrtWΒgjԬˉw!5u'r9loT ,6inkN.RV6 #0sH=uv d9[uIg dsw/>{cM>U3?ȩ/<ˌx 6ܕS%ñHow~B 栀     ՟@@@@l>3jHd[NjDk=hY]Y\՛/3:>vOھj4l&06ꯞ5вey?@jsI'*ire)ls|I,/c;.Uy!+;bRy猑4B)Yp2NnMcIg [B7*f|ܵ:p{NxmA..?GCMi)%U-y9S|ΧQ ڹի/Cqˠ\,c-˿2%4x*q;F;&ߔ|٭*2~l.ђj,+u% vcr/UI.(q/cK?;|1X狖O.F?)u?]VԲG*K.eB5$9X/ jPO#nW*.FyS:4cs}-,pd=زONʐ[_OƸ:it|sǍʧa5D&Ʒ,)t{#p&~5wVaHC b4M 8N>b7s30Ivp24R)MT˜t]탖y睁٣&;l0:)>@k^dțUqwUB5PÏTwPMy*NϡtF3G-Te/Lu^v7~z˵4/8H:ʜxm~"ɵR^Uc =@9ݾwrqfmX{׳揯05sek:#dV~ ?yE% a7:rG;qk[|n}š]+{D*;,.Liu欪.S,6s$PLMFO v|r<Q۲iw%7KirzEMީESdL\놎UG-\{=O^2|~ y^ayz瞫+hkO%wxksMhTDCux*w;S Dw_%3пvyI߻`6Bvr'EPƇd5*;4ݾe+[hMݮ7Q${vv9w_[-meKòHiuyGDA\M+z1?N6<'6ոu<y_+s@s"VKni6;4_U$'v_9ʚxSxY{ju;ŶJQOܽ]33ܒ|xqO4ʹ|O;nuprEUGF0IJuv${>8M).%42v碫KK-~xa#4ƾSYEL8-sAۂ9yYģ~.㻡(S|qEl!W%=.7=N@s.]pYS􎴲".}ʩp :׆'VH#ltsfhzA9E*xY\ɩOy]W+:fRVee5{CaCsweuv%RA;A,]VɁђRr%џF^{NJN}컊ˏY`F ~[ɕԲ/ox>+fv˄tϩ#¢W?pT歯%2V9梟IVʎR Tˠ      ֟@@@xS撖p:QrRI(-/alJʩnnKMYJ\"Ǖ:.A5y.SK,u]nqfdf v](^2IiR|3l+yi8]c?VJOKUS̀R43m7mkTlԥr $C0ʻwśbr}Gz*t]:Y|g18̍ԍ,v\Zֱµ)t-X/a"9@5'QnF.M{Qju>^QӢ[ѝ_ P, i7\\|i4\\S_gnwA]wSy/ţS1#mmҲ5IN.@ qlSaK:cکʣLI+I9M|NI?C#^q8{~WnUZHRkyrdHo9-#ʱtjsɵ&ZKpӪBR]Ȱ5,6꛶\ ,TKlt-ٯ ,Ee~|9n8i঒ܘ7]7̍- <eV:[Mi瞞{)0nvK܊RzݗX[jH:^~5EE_?RI乗Nbtպe[bQ{9."b)|FW\_e{$vA7 ̽ 4xK_:0>g666]V0v3;Uv6ls.hNcyRQ g:+udȮi)sBEoj&N{]6M'%HMv7\B|9-ش~&i0FǡBc9ym_#y<)=1 YƁ_#X0>7590|⦯fi6kԩZSrʦpcA@@@@@ן@@@㦇p}r^bc;.j66Y7'B5q1T7Q lZrCM-}n ;~U' .S,b8-}|2 ٝru6hh)e%}{}v} 6>ks Ah;0熏k;'s(o?g,WB r2ߘݿJv^.+0 W6xr*oRIy%*+:IK0ޒ_3ޚAm 8e;eXsі؞m9rgt',=~|ZC;"-].ͺ]aᤞ{|oA@kl?--=!ZH(9,:_u4ͥR=9e-\ |Wi֎/)_kVӫh>;iU;1{c%+pW>%]43ko}=X޾Y rwGrw޺o:ѓ"C\>Zf烲7[_zT̩lo:؎VQ\` ׷5ů:|uVD˸N_\U\L-NR<%ƚKyhW3PY޽ fuUVyfiђEnz*Y*Ac$wlg57,Bi.*g5үsh. c;k\|uize|?Ëbh1νXeh4ޗye}[Q{VWכӛ˷f|48-\՜gRٿ}Kle9sz|J_6ZU"n(7(eeãk5ܑr_X .eY'չ%C=}C,6uo|/Hitey%uG3JHZ/{~|;4UO %}JMѷx&yr8 ӤlF$7䌷UQЌ~n~=Ype$Q=rwZVGteʑ˭]GxPqg`xOPuQ ,-tu䭽c2PYY}5RHVJ 5*7R3!')Gڶ0Yk@j*t.,qmWt'kb*q>Ut)J޲'f߂Xhc~w=+!VVw^rQX2;D>"\5N|S4ù*M E׽)Sl+ܚfOMJ눶V=0+[?.EtObJ9c[Wtc++Q`}v9i5lf{ޚ4+:>Lg{Ԣb/i9a9ytOVdv=;zAas,~km,xwT~\'gab|l;qZ]䷦W F+4"]8h\ \mN]צ&ɑ`vsg; V:Sn>-7f' oTqY>ĕޘg3xKURd˰$ܬFFE;~F6yJI5gɈ@@@@@@П@@@BT"}ic};h@ٔ8Q[.'CNs\ l}VNxkVIo'UvRwy:n918 .qWi6gJU\xjD iV XȺ(,Ξ'st)Zmy7U,8Ǩeigv-tB84`-QWQ| hxt\q k.#+(SfkX)KrH݌ѕk=,=F(,ѱ;iQ˦>Y59|dqT48rlF͙WK^]h4>!wr/|B&w3*lٛ\\|BQN8Pfs⺏6Qp:N ZsߘuŎJ\0eVU2=K4̺ Jwl>Nj*Ы\63k\ X&eCP:{誾Hq2աdi-x*qYIt}HfL1FܚZTgtuu'2]SS5m~Uʓ^X߶-\;6y 2ສSQ_=-4G"y]344ZC3-wm߱Y$Fu؛*}LG?vɪdoƝ9Knat.堿ԗh_ƺϴ簮k`ih5]77s>}ɔrMU4Ar~#q'pr`9Z_/]:| k{[mt-4@@doTUv?KbI); E̬Q3&[s9wTuhSJurV-lȸkǦQ4O|=7ysk^\\hxNNHғzMh^E+f\6eit?WT*ũ$@ji]R6wvm{6Vt*hXK 06$h4[Lq_A kf͙+ݒXNn{i~e-^ɳ)@0~u= I+VQk[}w^| yG}(ㅂ7أi-n5~x\W_:iTT#,`ĦET=:oXTw._Zv-KwsL]hm:.KרNy .7|N-bR]\0C:tTpuȽ9((~4U;ΖoT Z\<;nj;BM:cbnV4īue>ſ2G53K{~YKn֎@+)Lqdbؔ-/D2&| m|l^hH4)FUA;'gU'ۡ4>V3+%s2u&qF6#]r]6_YW]$yQTӨ]WC@@@@@џ@@@;}{}/b<=IG8p0lj@*j.C{[\_Xs7 E*sK*='^[eokyES[]Wu[sRV!Y<%,5SOM~vm5c0\U‚M%TvPVi\5U?g'7]ס>ĨϹX_n\| UZ_yp~k\zr.[Vs &ӸJ+ӕjn+yx_}vq 6ͦ詨'M%߫_9ooU-lZըI"xWKhqaN(C?*EGYъ~Ye~߯)[;=4%G-JJ*yj嫏Q]fvɝcy[72 l6s]`ͳ*mNirEH,[amN!7nR}5^X^&=QU:ākճ\~e+d}#lVfRӒds[6r:M)xWQY*m|63Q4ԥ)pb'mJﱙ?z;}˄-[ -pkA ${tTϏe:%O/N" v=5cV NQ]j3icPY+ ok$VǾîv8WӬmx_c״sT ^E3m O8 %?՝w}L"\=st; Gwm~8V겳p .#-u~8%odwEjs?K} >{Raj[ׅϠh\]\_=v2ٓ[}O Cfɯn'y%Bpr4q\vwݯ]Z)uM[F-ե&Z((2}̷f]nŒ{I_+i Q8Q{ TòӝS>C;N۩+uqAm9ўRX{ n>bx/^wz'n\{ӻ ֚MRnɮO4=\b큿+.b.OjpNlw" 1ICn-+'|ۿ]OIw/RM-Z?MLuo\)ItRz :Qa^}$qMfohmf}2o}L%}y>}zeOz"8D}D"N2S}n%!vj[wzCZZ M|6W{~qUhmɮ]ZICʅuBۿJ霅+Hs6x{Qhb%;`=KÆKb-=UɈ)=WˆShDo5v:lUCz3m9 @ "ЪRoQiJ4-a-u|ڛ70n*)]c:kYR;8O;tkVwS 7E[ͻ,w͠VjuReA7~T`s˯g/B;~v33\k9. )\ecK;5'tyq:,h]zyeasiUN|,t{b?p̺m~K3*2BN =[F7^67[0w:~5i'σ\]b3^v#R,vKmهow],}>ۖ˱՛MUQxSM}1380 1| ;[=Ǜ\̒WY;:G*tiת:vKE%d˨1     ҟ@@@(DG 1XXDRa/b6ضsjQ ~y9~LC 9,m=9淬}:֔tJAn NW:B['b:mqWN,VF ^䟤t6pұ&~$KweNvU3ns6w|>K%} FtG-׵V)Y5ԟ+˃RԐ_>8ǣqU'yXb~v8ָq`v:_eB3}7:Uk2{IKx9D;9.y)y-ޣljz?pZ;[pJ ٖ|c=з,w{{1yTc|G+eٯ ]_gyR>֦.t鼵|ȩ9Dr\0G^aq%wG&G ܙ(~_s#%JQ_#Ľ4;;[æd{N>W-U!v3jW>T\9GSiq/PӫڛYtw1{^݊[%xp6g89$+c{ g8ɠ6ha־POٯ%6?yo+5'13 WRvH&?ueY]7]ں:b=EZ\ty+GaKuX7iu4;Gh첋V]C¢]N, [vIwOEeƸQzsu/Q(kW:sGeUZ=q `k]l%E~/xӨ̤Z$[m>BB\^ű֍Qh{%{Z"`ۢQljZ5Wjnӹ\/P^ ͉2T"*96d)+#So4|lN>׹ܮ|Fxf o,gw`]_iFwavTCm .֤)tewBIP6WUnx;HЋx._iN2k8-8Qkx*}6tp_:s٭HeBҗ{2_glөE2X*(RiJgr'HK]};NxpTq/YU9bq}W׻D] }v;'/ƌQ,-ֱgȣ3H WGi+q:9ss$s#kXRO;Yii{ߝsl 'R;{54rYM'ϱuămwe.gl*Vmgn lfJ J *d?4|~Z|Fo~+JޒKC#殎/m vWҩI;7M}sg84`!C3R%ioݱ{J;}ЁOjJmqUdT5nnSQRнVv/8<@@@@@@ӟ@@@/D;\%Ѻ MN@h$syih r$v[mzڻUhт'9vޜR2,j{+\NӒS1P[(B+ebӗS{Kyѽe!umω16[{8XhC8,!ۛ츓 l i2e̠^"ƭhe60y h7e^~EeYZ U˯(pߛ2y}v7nsKykcK'J-2k}ämP)v>,}0jdLY㦋8N RrywATq:RnNB\n|Ѧ/6,3VfsbzKNDMv-b*6Gz$TʍS]gщ:krGo9] TKWmw㮌*:8"^=obsd>|Mh6[ӅjuT)c"Pq|"ñhijXVc7Q+P*SqZeԓN馲z4/z2w *h˭O;Cۺ {Gegf|=ZyLgJYoU*߃i$87sgx\FI^c{^%6MEYZYkuq0Q;YojLi4ԂuĴ^yg+{Z+oiq@ݥ;8t?XyBOP.}Vn\HtS K+t#=e).\]ż,IjdrWgQ/Y$*<ͮnup9X+Z ُujR| 77`-ꤗ#\ӡ៸t@]%FM>5m/n'uMssD\H }E5ve*6ܷM,ggoorpJ)vV;ݬ-rU$)kF8.m}JG{e|]:Nm_Hۖ04socp|6TKq9*VZGzA[*kӔV2Sl68\DC1_tԜaR7if8^>+uTmMЛr'dpǠ&3z˅h''bKdPABQޣ 9]ͥT^%%n,4q|JI3;F_;~8Y;sUS\56())I+xw֖ 1y(ٮiu4buv{Ӗ<$tgV׺ n FmpV3\8ZLJ'ly)Y\Rգf$+ehYq G w])觿M?c?i~R]. }}'9*m"r熛7[o\(SE\nϦh~+<p5 x+I1KiI_Z&catn׺5iUToK3+U=v|αwxW n:.+VPe_W526E;[{W2U{0wm,v›YOI/ՕqKJ\ gO+p.ӝ͎[M,>€GٟmaVeKJG 뢧s \>vosWͬs}OtBt4l.wcSُe?"z4E%TjRؽoSV9AsỻjwNy^݅+܅΄VP(SU/ps;҆$5kRLk<ҸƭxI[(5^,[63!e|{\LͲKA6wwnXa^9kԺw<كH7 \~E, _%X匵}Su޷p8,|n]+.%QCP }9Ǧ+q򕕬_5I6̠1О 6$yרt}ZMG6;>vhy wռ8pk/)+83 q\kr*)}֛{Ui۳Rζ~]a٫*S~)Xehl,dlhkXZ \敏qz:憪)!lhMM>.%N9Vd=8W*Go3nf=5QtkI'nawq#EyhyL#9rzhGGFdM<*تi [oGkW^vfTԞHq"gFN 5nuߴ#)9iw+j,a#hbwɩC_4<=9EUhw-H {wUXQme*9YEG;mMkc#[$)4jz6ť§%8lX^_')q.c庨 ||9)Uݢ<\;6wAQW|++SjV>ح;[wiI=SO?UN;1Nu.nrߴ`~epym76t8凯O '>>I }}[MȸdTõ}Oɼ36XN2w(}a+:zz=oTy"lnks8j< .tڶ]Z*Uy.{mRQY?C =57á5'cA R?fqmv_Kl[|ܕtgF`}Y؋*K\\ ~۵CbmrNƝ{\g{_Cwl|^j[jH6 խwSq`%89_,Wh$MgwnqJ.}M+*RͯV~?hdJZh衆&66ɭ b=±q c )'Խ9up螑Fm{jө$[%xnW#PYz*x2;UNRq|%j]. ,ų2誩Ća}#tF*Xgq&am:skdP^ΜP]>~x+냺W-T9a]_쬛/~UgVƵW$m x}aO\wbɍk dٟcvgnle= ٤ݻof'in^زZQ>@ϐ{K|Q|K=S%h E :첦$XYu?>̍d}fq˟ĤeQݜ΋a[;roі̕)ߺ4vlY{/fҫW]GsEoԓ:x\wή]Ŕ fmli<obnサdkE/\M|mkX:-Km|qvW9qk;JTcWL3Վ=84oR; O:||ff]8:.fj̤-"S#y+ǑQZp2"9\Ot7ȬjչT[Ki~&WT;s vk8׃Kѻ*Sj]^޽n>p'rwmҝk]g4* ;oD +Ip{Kx{1E͊ݡQeJ;C2LxXtSǔ}Hhq|s+OmSI[v,ͳZYsk~Eh­:s˔|~Y"K{ wI>ul:r6jOؗkJ-Ahw+Ѻ~-]d;$]i)/}"rŭթ+;Ewߏ-rw {GްIjHܸvMwp*v̽|+FSzɤM5 K(fᰓ3O\Z׶:GΐݍJ:SK#Jv] *c-r>FE^bk` ngD]hv/RK\Ywtry*֒<r4E&oI߇ȳ{; h@yjq:;ղXjyLxm{h j)d=/,[@?\(%бF[G9_/j7m%%&Y\]e%jSxiC6O."2ԕ{Tv(Y{z- b ;s.tn^WڝyfҖhqZ , iK6:خoc_  e6Л۫:u][r_<JmJ%~OΣzp)G8,kZ5I,k4˽)_hM;|7)M[{Iu:pT<@LZ.9]-qf읠rogB=}Zѵ^J9WZބ[WCru{e+bO9_*7.؍W"-jϦGs -%VSنl>Gn'1OU/tcvmS[O!;Bv:Vpe?X'ln-X(Z-3,yrx'g)mrXy <2t"pvWrܹIl~a4{X' ˢUOO:xO2ӵv*aIqӁf}9pynvJwG7aV2] g9~}u9iIm# $s%ߺ[²U1]!GCvٙ5R{ , OO"{ᓵea=BWt %$iEū'ak~kmW${GGէe [\hKݔ^?toe<2UKUQlzWЦ|r4]#7ϰF&v0M]K[R3;NY|fJ#S0VX{n\PFb4;8a(II{6HБh)5/5'dٔ.Ա5ĝѨVWvhg+]+.m+sxkǥTEO qEש :}ŷhElΤܟ*  p,3`p2SO$|g=.vw)Սa?d2=޹Ϯɯ''j!Вv+Vfb%h >ƥ%Q7ɯI>|K nMΨ)!j<_٧yGْdpX:%kǻ+1UW`X5EZ:gFݙx.wfOSMJ 5$RN>      П@@@&?DLme¥ I_G^l;Ϸ?G(i 4yh"0YNW9駽fb35ş|cN1q|{X/ko˼Q]oehj\//\Xcjm؏'|ť=u^Yfd!ͧH]s仨C%7AF W}VSE&y_+v./O8:Jg{D^vPv֨2Ckmm6_n|Jh>ԫYOEͳTsǛ^%YK{6+I}Q^2ěffkTPmȿ%Sv}72v%ܯf41k@uo7bdIUjch䞗]*($:?SY} KuXI\lWÔܶV봛,TJ贩5} 0*f3H .|ۻnK^WԺnϞ~=%Dt}Y'f(ǝIv{N11Sȣhkִl`V%Vznxxˀ i-D=%gbbQKˡLҪ8%%bbKEͷςS5|dn-۫'dbĸb:x+$[o-K39ۭ.80kaZ#k.F){\ui\(i_r q]GU<<-6#Ǚ]/}NHm2X䜏r[t;ry+v,~KNXickm亦uhn{G|Dj8_GjCӊEmy7\NW9jVK1ӓ57x{=9HޏY9 lZ#M%=9w_Coݮtnu׉^2 cayJ.:}1\ρB<|屰zW=A>Ej^4'ۃZXǺW[]cw{J2zj0K6B4*lykfg?jp6lmʻ?6#bWI㘸Y]0϶*ЍZݧd  ;EYū,TyNX=~-ۨ쳒iRQU׹dЃkKuZTS!߳ckQo 'Yb4ԕJe쒏_yR4_CBZUh;pbgVZn˛)-nSÖX| _ sx}\ʬKAO&1bjd(ljCٖ]I+>7%[gOWMlSFծ(V x'M꧀8lDo!y, gqLTk^TFdqY5KFbY~RFѕu>%;$YW5&W\_{@exӮ{\ZA67[#kۇ[.-7V w㯊6RVӳM;.IƫA`JQ^| 7Kvc$WFf'/uCq@'Ԩ29 !o)}X쏆z9\v9*|mVzDxx }]:FIc,XFߩHR2J6zk+)c20}!QwQBiypUx[#/wh-5ƺ*T"ڿ'n¥X&di%{riۜelが&}%Ė}Jsted~}ք {{.7muKS䊜J5.<#&5NONI^x.dciu͆4^6Eft%6IGbyD7vb} uaR_&&I颤ӸkfQRoT0umWIc+F缒QCfpU;~UCL5Lϗc*%_yr{t ١Fʔڏ]PDx㉂cZ`N 97MHCWCh+Q\RM_"=(8EžU2~*tvMh^+:oԫTغ'     ҟ@@@;?D3\-[TʪfF9#ky^UR~Կr[?k1}ʴyn\NzGQ2ᔭr2'lQxy:o>62Ke?c$kC%4/.VJ0SyRt9ٮۆ;OM?ZY۽;ϏaRfy++cY2\~sG%KgׇT_Svݚ5vAcw}(5c Y<|mw5<*Tߵ,w}y: dh!뭒׳Xÿq ~e\YwowC$p^Kj/ZxNgS/FcƁܻUQZjI[o.߁Amap:}]k+e_=Y&9xjz'n\_#uQ;(q}$4](!<ZH eU0{s}$LΞY/ >bIm|콠UӻZb|J^m=9IևGw8Yqsp̛|,%ݟq}E~z6W}IT @@@@@@ӟ@@@=}Vpu,Nr]ҴВ{ÿy$ kylZoOYhb&mWf\Sfxp|-W4O}ľ|ϖBผou =Y^Fk%>lYUc;.PW uw+9n˨m*N Y:xlAMӜ4b)V}kk.::km< U˩ETx~%CXjsS64AĶPtuYcCQڥ ]L -k4aZrSѫIcpyv;,IbTem S_50y"EU.V풶a#kRG0N/w;ֆRWM;pkF{ٶjP Y}kkSF[Ǟ{+w}O%[YMԄeɢk[<ӭg,m;Rʷ=/)9[ ᯒ߮m8oV8ԽbJIjK5,qh=~tKwC1Ke^OExo,n+=vAIԯRJy.O2Mvǩ]%Ȩ vITwe$x1r{|~Ppg_6]cnV\ =&wKI?jYu=&kka [_%Bz|U^ڽaՅ4UT] \ E`*ֳ/|g2j/%}>߲+ߢl_fX3t;2XkӊtHk24)u6}ӶRzS&Cz.J [Bv~ 78N#7hdY;k]V{.9o|2i6n6v?T7Рtsn]rVK$cN Wcf7.ҵ|ӗ~>ď.i } B{:X^A.KYjQ%Oq{]gֺ$:-NdyG>pjpvM攴h953sFhY]o~W&ǔV5uwqR t-pbJyW~SXCC{{96ds!P\{1jbk7q}5vu?:NN+VoPT&ú E_YniлWiws|ִ\ nlA:gMo۴ncѕi7vHOm:|nɲfߋq,OU~EHЦ7*hpŽ~ld7>Se&fo۝GKԾұL[[ͽnX=y^|_#cs6je%hr6@*SŚ瑩$\ʞozQ :جؿW|,5wΗ>%tG ueR9=ARroJirklR[Q͸߯<0 6Hi9|ZW(ΦUCCF's[_8ȭfuOo5ǻWWX]7i6hס+<F'Ї|*h*n^[#48k 5o5@*;$^I^f"R"@׍`Aᕱ)Zy->tP֕ )QkTӺ} Kj\IMCZ|VJmXnEukFhtsQF-Io`omSt]NW_S!Sdwl.z6~Rߢ/ d^{)I{|sڎ\5-OKʪzi۔ouO,?ڶhVxtˮVT1klA#,jF)Qv1x΍fw^K'O}J;>/?~UNvi(KOeZ^ݥ1RnK@RmR2QG.HI6y?4\W+/bkNeU-k*W .KEsGx~p3{KFܴ;yrEHKqwN=sլf`i\%zr߾?E+^-='ng99v /Y-uIĹHnPac{ϻ!Sk깋w;U|/g+4k\}%Q7G}JRvk/$ݛ7;lt7ߠV-ߨs:=c3:mRg{mƮ{9"sՓiZ)kĐoRFVzAE]H'{`s]Y;7~+^&\l[\i[w/χ@Œ|%ZBmRB_aokSSG6"FqfUI͎sOݝsUnrk%J_|&<'p77S)Q峽1jdw)_swMקG[rL1b/ }]<#^R3Basm-kxDԹow:dwuuΧK=FUUy7[yR-kNutP{3Bj76&K[xQɑˍc[kIN-qgVq#=lZկJV`/+&nT,TeǡI][:./cHŻ9qe UFkUʵW;һLjRJɫk{'Fz ♰n7)f-tA$9'<:z:5}"FNuc m78x9.$@֨      ՟@@@5D[M& |+LB@=>^o$Pڍ}7e}ҍ8ד)/Rf-'Rq4sa`D6'=kp\IJT`L-s{nY>^;[<0N${\iұy^i-+[N:0Iq7Da^O ۺfUgN,9p]^n_2Hr,ߢeJRIyȔۛpYh~\ѴĤ2 *kNOj᫜<ۣrdOk# c@TuuZFκW~b(G5:?qWnOW.W)iE+=u>gPQW"wHl{W+Z;0IcwwCs~ܩ)]iԡ7io=#k]H($}kR(_ "XH{Lm_PM8A/ⶸğT w<Ÿ<]N,]L ݋}{IV S?]'uxRj'SޚҋT @@"A.q`lT5u.W4$hU7{.6-6#利)V$(Nw}T["ְX1yFvn v/*ا ]Eb3 ˋ%};ٲ-+kvmy{5+8gd27=R}zy~ؾto6(Y*QsI[fȶ"5|)ͤ|0Z 6;O*_%p3if:il#Z3ZN.]y$K^kvyE4I7vo>G)_$TIN[w-u׶+92ΞgfM!~z. b-FK j8O%kUDdob%׋VK-< |[# bah$ XL5{'v*ԽR$p]- ßwT5ɆTSՍ5skNIzٷH~TS}{_$$&8ad/m_ddal/yq*]2Qf*}lqhaW.ρ* -MG-1Q@`s?4.ђ"Im54z;~V2->Kܣ90 {Xj}cpoޚ=K](46*dfV TᄻW>:W-SrJYa8cary ,4ݮ5lx[eyErs SUov3CkIZ +2Ha+NN]z$gN#] N.mkVvOi[g:!l{Vp\ůMl.w-jVK٦zIB7*##l2$[+qwJ[.V[ƬIK&@‚߫cMßF]/h7E+й7StӮR}kxW0=Zٟ/ s>ja5cqˡ#cnIv ;=LU=jSy_Wyr7'@-)$wwfG ;WaqmU{^n}Ϸ/M_C΅7(լi8a'm7ք籍cր,VC@}r85O|hNe+|p'+'t=_å?P:iJ_YxĂVR(@N]5eY-aӌՇLatB'|w\g֥o59X[g=˚ײ_EĒ)QZ5Xq|o.wmPJg;JwTZ|wj+KE)Uh6)$ӿ!z+;$EEdsw UqIͶB~B-`[jy.ig'hvMŕYH[{.mutRޱ/5K@˛/@ob&2Y9c(b@`a=ߖDzʢWTyԘDRV,3Sĝ|?Rَ򊚒&[>ڪ;>VINZאoՌJ<7PdiP'00v&OER('USNk4:Gs`}.t+ST]Ul,r!e‹ K;s(OUC9eWeNӴt=Pib0zf7>kdC6ΙKu% s+~EJ )a,দI"Ĺ6?%]7=vy uKOVwvxI4C,]ӿa=cb.-$1tkZ˜`9Ukv|:'iRj**NRzF1M%wԆo3nä`eF#("1Z:K)\EXg3owݣvzWr[G@.ć@p\S6jw{F $ǵKd 3ld(\I+YXfW eM Lԓf8p< P#R;rm^{wjaptp7SR@Zo =m,=;92 >JIz{qvWXl2b{y{j8Zˉ󁹵JEI;ZЦ儛u<;HAu]5/cw=wx ͗i-/rqýYcp$}jad(m5miLs١ۚ \Ν(e->6jt|zY0is&=[ʞ>:0{γݿ}n|9ȣ'0xe|9V@oGH<ЪUy<ҍrck]%w17+[AaV&Qd;#6s}mL䋂     П@@@kbqqW6 |قO!R2[}: vuM}莀Tݓo׵˙cm1<{;~(c_lԤb__!Rq.n֧XMюvw/}I#"'qlBlvx\r^:eMK$k#i69X]{-X%>a\l6T4ﬣYIA;@X[4[]۩k8o~Lf\\*~ŷ_*c?|o(9xjW\xlY%eM+Y''] 7b1Z:7s{3bndy.Ჲplۀvh<*ŨE4UE;Z,fx9_"ƗFMڼse0 )khW\ ۧ|X+ ๅ;X)֚/V,6)![alѻ`c\`Hmy֓edz|ѷ=u=Z6Sq|Ӑªɚ@@O_Gx2#!URaa󺹡+_$ZqGjlI?]fܗtlNcM#1{6]e(w5u#ݝRQwxJ;טC cH&s+eenZzHI]jEf6t5ZQDZѡ$5Kg\k\K?:96Iv+9A1׫ʋeĝ8[<[#V禞z*va*lU=iXH0߃]txz=̯ Xٓ'Vd厴ЇNWBu,ҽWZcf"ݢTlشۗkgN٥Og/L^oc\AˆYX:7Đ-KT,*}TRnuޗFF>VxIvbw\Mhp]e(bK>mK[{i;|?*W\ |+/.4T.s^ Dv5*eF\9$&e{:*~9*SMg͏m[<*UT\-u*5\! ".0.QSAL]X>Zs(=V*smmw\A@#@awYHG]Iu෮/^t;x!S>*{ --åc{>ЩeFPzm?jmX´~;=r6'>^#*MhraRۼc~8Ի QkJ?eߢvm#:G;F1kbonz*R4QSGR~wf>?JضU{c>>&܁ 6q:k໸*8^:z)$+NQjYC(Tvo< tTgT{{| k;/VhfOb*%\*ύXk.}˼ݑR),ufZXZ;ԋ19GeGW^ڒaa״e|>( E8V,%~ɼT \  Q<o.7){2ٔk+/ސ{7IzzRz*]JDrfrgò?$dѧOjޔeׂKtr@A@@@@@ҟ@@@_LpHZ'sbFu<цΈZVGտ`>*폤*d4ԫ<uMk g{ruoɈ|Ml,< c Ue22mq{ѿ(亻, (Tm;n$g o,$ySOL$Ԫ+mfʪJ~zQeTsy}2Rw QjXɭ;OJ_l5{}Y_qٵ&vOijX]{V f]w|3eXw<G[MRPJjcAa$ޗg28˺rkw,sm`실Tt,GM+iJaOym7zrmߧVǣig$xtL2|I#sL}VdFƵHnӷCdRK:έ"'̒nW>M@@8ѷG1>v\3q.Jl[[U'rU#nɋ[Imgx,k3 e ^efSJC麴$"FET&IpUGQnO`u$^ֽmsZڽO'ؿXR%*UR]XN.Mo7ٯg~Z+2$P"7$_[7TVy2pa#:C3{MOrtQg[iK ܍%*F1F>WQe׳GyK~UEdJ,$Kfp:ٛC])NXʮ~xTSߜ}ڽu ?کCsh&@@@9_+8ц.atW8[Sd.GYGy5{'Ha靝Jtn[tqKn4ѵoEaps[wiv%ff*[L}tW[\$mA?q7l7ieקO NP@kY]#ev;RS)`a:RIŠw|L] {cR vP"ۥǿ޻ŸŸs ^˺Ǜp,[b/2|~;TҕuEi)e#)O5J&nu7-q"բ]/On/nWԃvpsԩ.+ㄓoh]|ண"5 JzI8 u?]ma+FԯN]k4m{N71?ZVwrvŋL**!7[]U|$VS\yIf15&+LVs׹|F=-Hm7Yw*gb&      ӟ@@@]Y~/q⎑Ŏ.oh`VOey,ٿ>YއFtN2˃rz8Dz(EnMռef='\m"mèˆ<VNܗ!=t5UTVOCg]Jӕ(;qKc{I%:~.yݷ_Ҩf>M}Jkc/);rNPsHAuS-t=[;NyLج87SO:czZk%OƅskfT]T<=uζ[ۏ%25Z.y\ɢќy7yJ[%^`_m Mrv3iM۫.ܖIZ&_%„7Ϩ2NX^PﶾN>[Lq@ kK{3U)] .+WYh }~B {h5zWhp˘^sk,ss[޿e..iR@     ԟ@@@Z_JXkxڦ,oYmJ&+hm>vW{6}a#P5Y%i|^5 {3H7}5\5w.$ N@:Fۻ͕ 9Z\dY ͑_h=Ɯ(eYzѕ]u*:q;r1ğ]$V2F.HŽJ|z/U|jfygɑy]Jy5GzV:}QQF=2d+rx@@@"B8 jpQm8ffߣ@v}Žx_Wӊ5ksOK'Q.jܔ2(W:=:RJH¶- ^Ocœ̢G#v22]k|v2v9lN{ a+'G+,7ߖTmɥLjRЫF4;0>%Z+]"M4եչ]\qզ#R-h$t]! ]dJIvwPѿvYDڜ+W;9Q{N6~}\$ʚW>|KIAci9sv.ZI]qȾRF}ò6BcÙP n),6*Am%7"I7aeE BI{lmk}Epm(%MP (E4ʾ >"\mp4>luӬVy;\pYՖ#r붇v/;rU6?,z6#auå_pT%ϳV*Ϥee5JO0oN7>GHWұ.}=o[_| w|5mP&ߖ.[Ce؟4{b}q'ry:Oek-vVres;+4t/eU6l׷^H8d Tav\>o7nQQF)a,m[߰^q]H.5n4ЋZaJ{cuK8Y a:VjN5Ct(W$*oPM_}p@@@@@՟@@@\LpTa|eŔ1x#~"dimvO$m譎]X|cN4TqWD,Nb/bSJ 5)k;6S3jsvio_f4ܻмf^MK@:*mYGV;Cŭ:MW,5'vei̩\6rGnr%Pc#>n@A+ۤnGt=KcQĦ0TwX^ֹ]պpTݏTgt]l8WPHR4=kw[oY7uk=+_3ޚS{rR=>RPYj<Νnvscj>ijs IPTU޶Q:x? )fGʪ+6Vfb zNUd䠩AQܯs2   cx OHޏ&>ҭ3S8H\h\cO==%Cj zKNo6PXCK^YxT0ۗAm)^i8k/gkWiߏ:9^bvK~`Ȍ6'YsoWgeu2~YA|֝yh:æ|4⑰SŭuŲvrFNKjl5˙]bxɊ1-3CTM56Rg L+:XX㼾-SN:|v\89?O:[a)fVW_&`.e-pfZȨbGB*5vnJyvR=H7qźM7Gd1ŗu' .XxƬsOX5WC9- iBefSi[# *FVZ~$kpi,W]%PO|Dx {O1]Wk٢JOUfݩ\hC@~$}Jjն~͙6z]oqX~!q(ۏar;VJ[;v-l'[]=^o}ͳ%7avY6O0dlR5(w1T+ɗ;\Czigw)ҒWR%ߺzNGӸ ѽȋ3|QӿQ}Q='(Tw[wUB hoY,0 `,epβ=J=/H^epn>+7JS ͽdH뛋-}Ӟ 2JP{*3`Eq; _Bi˛[Ca)oz8mb*.3Kieums-NTݑiwM#0GW9 hH ;FIMNO7Ȝ#M&~vYw3QIͽdJ^擖^oUq'oĖUSs]}n['(Z8ߩxx}*Ro:OBJ94W VKVJK3#KngׁNHwrZ)cάd4]_؋O-Wg? qp8bݭۆ獭=sW˖çւ5RMpK.:[R:af{nlAp-n* vےYt!V; 톿7t)3c/z9pO^e;tz_\L5ŭ7l' Z<=j'01N _nݫcKrwQ>Eò9npI`"m$_];Vҧߏ- [k_[~[}鮵ȝSJH}aΉ&j^A)>X uF>kJLWrY4)G鞳Py(  Ӟ&=ni$j\֍ɍU-rOֶ=f'e HǙVTkG0ӎރӒ?}ޯaNGHI#%9N9_kxd̗@'Ys |E:yr}:eʪ7|,(wA, .ӹ=tTg#Df׶l| p@ ,^-Rg~r}˵͘Su6x6T,p U){/9]I+C lynEw]W+BW[iGTa,N庥(8"fWSMM jqE$@@@@@ן@@@5HQz-g־JXo6B=Fb [JY;+_F};R!Vi7pgN5hӄbbW/VjZ;粸icc.@\viܥFzII;4 CQ“}SORUTݲV֦^Q/7zp=smqngNeryŽ~VȞd n,_B^;TNG>%ci@˙ptqK('up19noS263h.e+m05mu'`f֛SWN!OgҔScsps!}JV9Ky/{EkcE=n1zT-htm+9;K9|oCTmlt/.S;4jԻ5   ޻>Gpq 80r1 Z@94xfuw|cFJjrOqz"~K5nK7J76ћg,p׮1fVK[]wy|{ni9=LxCkMv*ϴuMҳiu4 iĎvbn6mnoipNݣ(w'E 6h䦨`s Tʫ9"])ZR^ ~vy{%l\HF:=wmTi#O$'ƿo[=RsJ׺j+J5dN.l     П@@@#kC=! :i*8CSYsBGRּ}u;4/v=\.gU=aD? $YT\TncYFJE"ہ*y)_kVU>c(Hwtno թUn+)c7U;ng-YB4]7Q2'T4?)cnr~]M.&)i̽l˺ޓR=K&,EAX#.__RK=K%Ke)[V&;ۆ7Y$bi$MkmXp245=ҟ)uGgk%*7;S+>   xTGY LcpX pw N}d30ss,|R~o&;hۇٿO**Y}xM5i7w [r.5d4Y)Iiן{L2C =Lm;Ce[.QK^2z2Vwc+fiՠܟ9=;[}n}?~H%=w*K,6 ;ؼXtJYht$] }ᯍ [7KݼrNPw%[-z2Ƭl ek,egvwZX g%eJL) 5\? ~']#oUSb]oez SZq.DӊjI6:5-_bEʩKk-3*+si}8neh@4w,Ip[ b='NR;ȤdᏁm뮺nZÿi/(N.~6)h+>*<23%dԎ1~ѡbmnVni-_ˏT[ڌ;N=MFEo)wIFˌv1U`d M      џ@@@ 'j҇5IG ܟJXdMT6U֩+q:i6Wr9%-||]͖PyKE8ۘvQ)9^W2Ug=ws=H`yဒU#'{dkvݒ=JўWeLիkvr-i)hùrwNg﵇vKL_JϔleS#x4:g}*E=N[i(-P}a5{ZWYsid[>6ͫo[y,rH6nȮu\h0ng2%tW { 7 ]_yĭ-8p-*Qi_MLb'K=TCV $pk\Ou踄]y5O6J&pэ=D^8[(d _+{̚V4ӝ-.jm3ë9J׽ߔRIu#=\     ^)iq-Y&2RucޤWegnw(WWGOut{&Jqjͪm.Đ.I>B@ -YF*O7%O[_S+X{6)\ 7$\,tQUP}J)cҹꚖAKȺg6E{f1v3sTy\yŚ> h)t}*)f]}*fLp  .98JzƸ~y7uems}ڔz;fҮϲ-55X:\ Eہj`&eoRC98Z*]Z~.t!x3:[MGтM%$ 'N8\q2SK2}/O%)e.Fv*gCU9~˖ kHeВO;\Υê]ե& +9!}zFM' CeԊW{l'Z_ڻiލI_3z2mN-H$\۷qHcnHg)IPͻZtrǖvCgG7eDx=τ޳@]ǃ*(FgfMrol`|htMJKxtjƤ .qz;6ZF+o%/r*N#*}%]*8G*VpoEiVes\`     ҟ@@@808$l+_={Fx|geh՟LfzܽlуHlw2t))=n[枨64Y,8[=Z}_QF ɸ. 7; ~o$ ;_q>tl\y)堷x)H앖,C3 }ƋeX+9i=&I-W8<@\>h-'MM}>eQ<5ތfЭR6+( 5Ooto;#Ike=+MEe.Mp&l$7O 6%e}lp1tvRSVZݧfgN?gN10:AS x 8v}ѷ7,Uyo%/i|Z=8~wT6Nm~̑0@@@@OZG^c8m.1WF&%`qflM5>L{}zEGR]Attnhڧ_Eio'KX[)/k樦r> (YSDYQ&z\8>\JQZ[I?GR 0z eղӂ,*[mdVҌ+yYp7g]z*GfqAnAc-\i-$8߱;_ܨ3Y 830Hcv;P7-o+a5灲٤ݥNrNEP9 E^:>q2rǍ;Xoh~a5rTly;@b`% 专wݾF$XD!4Yurq-D\/?DhւqWrTI~GJ=d+>`R=SRF#=)4۰@iZˉHU-/[muZ)XʸA8 4LOkwmQrw"FN-(N|ցÐS.79/24q]Փ2~;~Mw>e CJI#vXm|~'.X_ai?<ò5|J:I*k,Hjl?T̓8o΅9,oZyv+x_QLɉDo`ƸiȴTme=u>zo٠&%f9MrYR'ū T@     ӟ@@@ IߋfwHcmyjm/O]v%~3魺ʴV*O7ڣXɫpMYTI;tZGWVƶY0fnZmV~=eڳ֕4ԕQEV);m[a&'g(/ȤKj-?QcJ_d֌_ U?CNZ 1|9s:W)půGz\=mrMKYy_4omkyvjajl)7U,9=8nIFz*YqoUVܴ?[#^I}@䍿dŵ;}]γ{jpW>G]r75At2ݳןY#K ,l *4{Ӻ8[KV+~he\GOĩUS;f7 JNVXWQ2~)\:$D=9s|,@E.6Ԟ-e!/OһCxBiYFܱo8Ҽ1[O@@@Ab Ŝ]7ZzO'/!ubA:nǚ#"i/t'UcةM]X~%*=usW*_%oEuZoIr9_"z'dn6 fT1vyj˷1hA%#;$ im_y5/c$my.׿v.{v#B떥hnX(߉k-#SjE\#W56-6 WYYf#6ԍ}qulj0΍Q.sxf6 ]vc+Gf;5fok(c<.!եMF56ZGOo3I{l֒@rzNJ8 El[WeC x0Zq,t~S= ZTO~ft^ҤW+I/nщ|jP@@@@@@ԟ@@@nL?p&< B x z*(W述m+)5wOf(7:TƤy MclŢVf-> ͕loFZ |Ћ~sKj[34]v:Wh>'XTg9>sŸUn d$^W{UtrtV=5)_1]ڐv:ygWuU/H*TzPh>=t]jeav1ȷӛ݊.e<0[(ku܎Te4\_/j8p}fZ;$Zz #]I\{/%a12ڞ˧  Ў ITi4J-]Z o po ፇ4u#^D6K%ⱬAYW靵MZU;U7/@@@@ŽT5n'Sv$9GQfJu yg-HJ_;v-4N..tYugK't6?jJ*:fآ44Rp'z{ x2z'm{xri˪e:+9|+ :;R/Ժ>EWk+/Qpn4&]7mpgpy\G7;M$n421M]VvQo+RGmT7]Ӓ' >І]98GOIgCU)Tjo6R}/ fn+8_#tV=Z+* hÙЋz8mhuQ_w]jgޏi0vˣw N+8(C#^Uڧ.'᳛/tK>sͻWItv eSܟ;??=bbTT@$!cj邴eÍh-d7/QMaRc$58.5 ~ G3~4rMU][]UPĶT[֕::o"CqO֑>՚Yͧc=Qԣun*,L ]Um`ވlw|1{3$Iȅ-Xmôj_jQIG%]ƺhdhmZoʠC{@9oO֩%:;Wt6OEG1cd=>7.6ֹMqqw_z׊E[b`#[xXnXǺ?[;-#t'RJ2Xוn᳹Aۿs.enT '?=L"- KղRyE-["1Χ63z9[R~ƪ1ŧNX#|Jױx;6 8v] z믂t2JuVҽ5O fc7{^eg5;$J)]:s]74䑡9K'wn_vzRө=k>yqw&ӵm >d0r2A@@@@"Bi~4`>.OWk6:b[?[<=齞k1ЛoQR0ms#ܳTY+t[_zͥk6j[Jaě/xpJ_#+=;\gζmm$uiˉqFT^OρgNV?ĺ_ұj%U7 Zd1{Ϧ$%L=75\wguW{2ђ繭 +j7u uMM_xJX\v]wANKHy)-͚3::;:;,i4oװ0=nyktq>/!Ui .^lU:FmT* ].-UnÎr]RU9à~d:G=NK<vߡGmS[ҝ e]Tgܾ/++rF@"߸՞1K>%M92z8> *VؾQR^`O?κ{^9AoYag\)FOHܱo+*sy .kQU$QNN2 c[,iX4T!@=v#?%5<Z>FOqO,R> UI)!9ۑ4%cf J}vֳZ.O4YO(ߕ+'.]a'n7v}kÙ]#m6`GC"C~ EDě5caֺ졽&cEls\W_yM=>%X8kvj>Ls^o }WYN[5;'mua\U39iڵu`V]?5ͣ1: vwx:mntMpwwX}>#~g9=5%ڤh%cA<&ZGto72GT^21k2{iJ̼.     ֟@@@0_R.:i)cal7ٖ -ey];7DFիT}TW{8hNkn,,uϬ)UMnx>Hѹ:%%rYte%ku7x(#ᄒ*9w:n5*T27%K8[aUэLO|m28$2Nں+/Ժ:\Z^'ɜ.Ѩm%eL%3dC=U0|W'QJ2q_tnO [Wz|Z[?E%J ?aMqvx}չ5l    ޾+QcPttr+s,v 'fR~ĺZ;&RҼ]N[۷'uۍ@3Hu .4k1Iw`83eV2+g[/Q>b2U|N#2K_S܆;mE7_^* \4. QRsj),(R2چrsC흺ݓ` 7yoKA#m?KӻnZ[u^ܦsEqTE%ӸrUu;x)^6d}VLxjB۫MϵtR.ڴoB6GFF*U`տ1EJl m!\NY,ԝ{ ^xm$z]f5\<%͓\BIx?XW=N ۙ*Ѿh- *U%y鋤U^\*/d(Om!X<7.]~k,j_3i|02&A@ 1q c,9he&2Zlo+^e"[z_uutj`z<|8wEwSk7< @e"HR\2    RWGRL/'{KO9NBz[8/p:4u@"qsQ%o5CYg?mғQz?iNe+FpD|FKz1[ǭClwy_ \6U%%8/)TOy%֮19@ѻU$_s8S~)uK! kAtA\ߩͭYs?*lq3%mrZL+\UKnٌd<4^Z>ڣ|c#5wqu܇ec(+6 *a[xb6{0~lxMPiqsU9${?,$Z-r%aq&n1x$6ue;`4rL3+GfewEkVn_Vڵvݳm85k%&XdeǚIkz[KeSj{_9VO$@@9kYł63;GSgѳ s@,;hlH Y,>ӽ39IoREj[qw)fV)X#{K^4Z,Aœ"b+EVM'KBNQ݋N.qqM5nzUDMt[hVB-vRZ+5W)- #StfR>ںnLd쵻1ph "v'egZOgunNþ<$Pw껦ǁZJ)+E[ )^.XYw˩kՖ{o2+9*kKu2J}Y<1ukU.W;!J$6ww}R3hpMG-'hݾwo6CH'~]eZ]+Ro2axȮs>+O'nASRw7qyĢԻ!Y{I_9˰W@<5e]imJd#R[6:$y|t-I]c&M+Zb[ߴQVKmH䌂     џ@@=j8W&GQ,p{ZӎH3ҾvtNJM}E箭wh4FڳtwElng٥\Q ::-Uv7ᩝ_Q !tzmVI[TD8v/*~r;GGs"2~ /%#5RyjҖh\"]w7V]xu9yk{=;6wT]L"2]%RX;igEh`)+ ѡ2}BZn'Iukn#;dM_pkRYM̟:I,kZUt.b;29_^|zԘg~90g#|ô{R8nB3RImNZ-SRPIu%RF\Hp     F[+kv9͗6o+ݙ-+$} 6GBnRmq]QGF;;K-_V5e笠8/kNn6eBU+ۮ)%4܋nxg%|'fݳ1n=:6+NdYZyŞ6&˚;ɮp|=b*n2OT.hMωUpvxJxgX>1p|?xQ<$[i1({s-RM>̮UlVip:i⺥|$&Ӗ~Ɨ]{6u'k<v:=17{%e%=;36Rqߩ*y1ȇ_j&ӲW*9ml),t-~Vj瞥EivnYp\?f >Ckny*ri \ѡ:*zo$_0G:qI֭ڰ^?;h~Ҳs͒Vz  iqFϵ+̌t4[k۫Ԯ՝ZKD'+|Lpv1  .= sVbZ >vR ~}c)4{M%|<1נ$"p*. !| kK${XM2Q2i?=ikONr[}>)I      ҟ@@}qQCuv%K[汲J~, I*a>߾v't9i:_:Vi@) 9\ڮZ*;͞w)]2 .I*ɩ9OC*{mqw<$CnchξM: &-}pxR9s#cGk} m6xS4j땟%#v4[2)Uy)RVfO)'-sɍihmH=g*ikehKeZo{ |sK6;ڋߑ?"4kws9* *˵p+Z8MekVŻ}vQ}L -i`AsrZ|;:k]%쫜':u53~'q7a5Log{ T0`"tv[*4)T#{]B62`p4; y2 XҞӴKiMS'Rm@@@@|x^ Ch6 ER\;;n=UJr~yjźBT:EZOEOk%&oFw٥ne[Huw[z9p9\I,h,Y.N"hI[VSR .ͧ}BQGoi pW"us[T\Ͳl;m´Ko\PRZ5t5Q7P65}2ha?Gg%$[ڌ]d채\lV |m̵V^~lzԽ!.gWz2W`rvS7?pk2GwBouн8u`ۿ n$+#"j@@@^)49d hڋ~ĪԥgQ~6tҔ 5"EuGc!ڞz^el7c ;;sjh|w4X~^x)N,P{hѴ{ClNpM}0ʊnz&l5ױ-yNZ9Fݜx/NoJWk3^ \:6;'n.?Pލ=JҗulweєeqYL`G3mct=lnófKu~䏾WL׵XZܸI$p簫*t^oyesIsMJMx/m4;ȡf7 ~.>nzxkcE"YY@nkr׹yJmrв>O|Z;*ʞ9,i:6ՙEi8XV-I{T7Μdҷl@>@@@@@ӟ@@9Db BfήsbS@9唖eԥU/}W;Si[[.Εz2KIE#Nvo4Y{+wFȩF1Bf#1[tWGHy' ':vwiWW[_<=:.{M=[s^Q9pE{^"ZkyU~ײ^ xpvn[.%,\ єuX[8-xqr24+ΞlsбϹ=}ZqR4/^k)uDc$bfm鉭9/~/TC0{k[g h-:1iңPOBEF=qS#LaxCyV"\m(׼:IpΘӟ#q~G_#A]'R㪢I5R1|6wĘ`W5     ӧ~8p4Ϥ|3A:/rW*W6MՋٟ׏ᭆ99 n֗w@gr}^g~SHWQǴo~< j#Ibyuz7zUW4ݳ~25m;S:ʔWVPs@'1'\=N\cjS=s?\ГbNwWFAqq3×DN܎9;A^-i.SW3o<#[0[쒩 S]$vƠG-nZ9{k}mң*>i7Wraz*~*+ z /suκ*S}:X65 _C-$k_FջXkqUmy<6?re 'x)^垍H &-TQڥR 7m螇aدdN'eLԶ'bgFHI2_37 0jc[Ҫ?uTz)RKKB[]q|cQʁ@@@8ױ})GNr:ҕGe=K-S|WҒߴIdzksXzp46{IV>ȳZ1 tURk9<+u56\\C;l`R.\(n:0:I;ϒC g9t'b]-}!*~Eu۟###FnOНݾ!̫*_)qW.y w>Ia~,{~ŒEpO5mi8Q~zR3V~]8Xنieq;˔Vַ Q1$ 84'W6eea;'`dI GFRwZb8HM\*6\XQfR*%g_L?jH'B | nϟeZ~篴OGNlއp41VDV6F=p ] {@@@@@ԟ@@&D_=n7lxlې2Okͩg;#crQvl5{3aEMϗyާpk IӪk<,yHYe\׹k%l3Q^"gf,$xO[M=hEqVޤkn۲ڞ"7Dtqw$ߝG.X;ei-! Zr \khwVOIHʈK=۴0N2Ty. wacDs鮇a*w\ ^o+Z>k#ʂNNN2]\dΖXE+ziہsNkPT\^a_TJ_ LB'[L\&ܖ ._R8tYԎ-hT#ldt<@@@@@]oJ l'/f#tՎ,km=h6.zs,6,wG:RMGdJ)?!S cXдuYT1_vMNd׼uhZ !كpEUZA7x *REVØo}@usc% E8^zTlc@НO֒n^auvepf`$΋81|Ji\k*WcFVeGݻ}xGSӸ]kIq>Mʔ7ǎF}VUXVOaNk"{]lʳ%+Ke-A-J\cdϩm|HEN_bd)۲ykJ˰b{rZ%u,=~f8hI6e:鲱w^:ʱOl_R|b\:JJ"i@!堏i!qR4;B6}r´N-DVS8ٌ¸k0lYt4&}K̜t]u,Iۻآ   'za=/hj>Y?tw]G}mzF_)DK| 'gaetͤjxz?i T|\Lϴe]ZJx3:!Y|HbjݬwVsfD1:X/}NbmBD,'h6 5lӎɴMfuw{Ivpdsu.j'뾟Bm.q)N-O;7"JvRk-O`rM U;5>Wyv顇:zY]d-HIܸMՍxi|mc [371&lӬRJfS+ j9y ,DuF~٪ʯN.Iť5Çu\(     A _QZ#)wd)<C;7vkٟLo=)'wYBo~ުb\A!;VF`[v>F7%h; ,֒3ouvI+J׃\-oT7=akNxxⱞ kgD[`9sW[g\ȸf'>rV\Z ӦI=Wrě|]%9r\ -B%l,ŝg҃.湭i7&uڦR'r6ޮw0>^=JNF8,{Bm*p&X   iX|"LsѷD1. {RzKeݔv7|rbb!7}v$~k+ xy-co73^ai߻|Kc0KN ei"v14~?| uw~FSo=Wg:H6vđw/?<w#eZKHG/]/6$k.@*:~ýkZ=}$ke\r7$Ɨ]yе[ 术 _v4CEϝJuJ6[կ/3CpHT;XTsKkkUͯs=D[ϱ..'YkYimjket:n 2U(A3@@@@@֟@@׾F<),>E &y ׸_SS"w'ӛ]-%Zj7ZMrSBACZ[}EUTI^Oy fuec)o7Ѫ=…I.=KkK/aŲ)+"urUTH,Jh9,6hxIsŸ39lf4\[b#:徤bӳ8mft -\vU#DG푕%ӂ꼬 4s5=*|Rw(9$guR\\LFm++܌-jޮ]YuSO\"MIHskff3p[zGJ[ԪVv;5T(cpqkuԑ>}7]'IrJNIҟBdijҳ݆U¼ QW:Z'AngpcZ7$V3*Qsߒ1'TPJ08JSUvܮDވxᩥT曷ִ(%Y;Xtޒ?IzFmVkv/UF4{v {cr*Gr     E'YMƼ-CI5Zd21+H5u^{<;+/e> M>> Jǵ̪)¦B1]m%oJ@3gzYdhc R;}պ.ڵ/[ĭ  {u)N^Piۖ @mE7umzēε:k9ZԩeSFQ4oi#qho#3yO_XJ2+IMO Դԧnj|.yI .=.I9U>Zޅ85k&Ƨx10ܛ؝zF:j\P&V5sstE;k.:nYu,u WU`V$y1vP|TWP<R:薷qVۥJIPa5="X; >&Ę7͔/i\zj,_<]- pޅ:~&c_  IPʼnTE$R7$ik9]֨\I<(ű*ê'6gG1u[ʹz5u/ռ<4Cq{@E|b=2VogyhGM,k]pZ.gyV'RrTRSMaq7>NWvh6 /ʎ7ZwXҤ#0 .F2ŋ*ԖoLio M^خQ:w׳iI#sY_[E"q>~TE`q~zr]%]_Qg]i?B]$m͸qxWx,Mz?kI7ԜICsο0i P3wJ>Vyj1}ooZx56y =K)Fdz1Jr-r[eu$mG4v:4^7\-h6d&jr9qmI$,ed_\p|O{Jݍm$C<ѷ`8sj[_VMk nVmX+'OL }mZNmArf u+w|M譎0@@@@@ן@@? |7e">)H]љzv)џI}tsںeTkءB)Vn>;pex_srGYSV2- $&mcm&ӳS sŕ/%,^6(T,o%9Z-hT|SL| ѽR4,DM6\.-nٷIJ>|2KR[,mfnXE4(cN k.Sc^VuTG{V͗+˄rz|L2F,@{^|JR:_6]1;LT')\U5M>^뿉z k5+/(qIh.D7+_#NdhKG6z)IoeERq2v6K}[r6}s"tڵw^"p,5][r9Pz0v6"-uZ-ibvմF*Sz"R=F}KW -/f"t~!p"~~>u2tb/OOh<m hKN|{, ̸>"@@@@@?*d[%jq>'vCs)ՒPiSϦ?GKJ'TSe:n/%2**^JB%%6<"B rdKj}[ j=Zqs[qr7ŖSVRrW\JH8ak]VQZEԪTo~ʍwϗ<}ͼ3{ڗTGħ12IapQc+ܯ-{RƸYqu{,k.eu<qKP#;[ K|$8@_u]ϱsiy*#䈿yirU%MqJR=ux[O *֬ IjoS%8n`umUrTz.v|O޺)m]R+Кw/RD,a~j@@@]IܬEO^!ؑ 6W sUίĴFfײNtgRߕX;0vU{-Zہ=/eIeYpvƽGviw-M\4]Uݩ3BqX&%2'QqM7hHuozvi-zՔ%)a}JodzZeёպQPy?=v;ƭ{ eo@'o>ƾ8 htQͺ*n/ue#AɷxgkEV7QZI9؝=5# F=:Nb韍gAG{H8vjZ_dڜ7W>w\<__.*QI# rpC]S+r@˗{[5Ү֖k}JʄW6GMdN+}YP0[HK5e-Kmk%Y mwS|/ea:UaW2'l*x°jQ|B0:#cAYn5|,߻?$^P gLUt6[iRjo( Ǽe*HzzXE6DѬ{ķwrӉT@@@@@П@@?%,5=;w-|ʞ_/6,n}5l]jy: ^6ݭ*Xsmzdݴo-[Ssw{$Y;+܏mW{)uVz.]e,S޾wsfZb2r)$g ] .Uc)5oŢlժ+9z_'ӱh[omGp')5WO$cOaOokEi9w-W$Eʚz'AT;ncl)žh-Q*ZQҳ{V!TKoW8xw{AA[Tئx sCnln56 +O_,JGC_z&ӳ7[J[uaKz XڽnblL3 6C17+#'sŷ|(jh'NU*Is&');ۻmvެ@@@@@@4?D>* LM9`g!/ ~qF)xGϬGڰ^/ʢkF.iC\쮿rVvKNXisG?NcRM7z6!$Ruӑdi[uBRݷ}{0aqd9 Өaͭus$S\|YuKyGX\ vu]SЩFjr#NRzkX<ضF^CDdq7e}5:-ol`l)J,՗+#êvV6[tk9ѕa-x2Ӥ:Jψ/]D0k4j~y{^ ]qzw6ќ [t僴LUy,yFv½#sdE߭`rۼV:Ze&mm *lťi.N-qXm8WKط):6z3J\׉,lƍJb~Z]kly 8U\ IS^Av x2ثY=ط%_!}I}ߤWL-#iΝ%e&cK[     џ@@[K>+R]gSS0_'WfM.j>bc>Dl8ߞR]r~Q]-1f3KF,}~ ߒZ#ꍚ2{=SR6{__x8d 9]6K-'uc,BVl+]r .B ws^V%hYe*O !CM\FMaqjemLgf2µxSYEsZ{ukyjsN-xTlCk4&7#Ytxζ=]#.b9/=-cV'&A@w=b-ȺZ>`jFmj[ {(q}(j@@@@@@BZ4q]l&~ɭ}E:ؿ&2}G R^'NċŏjnO U&}3JR9pni&f,sP1Nɔyu#R*K^X.H;]O[[BJ$9vqJg\nam:(N`bbKF~7ge*Y] 1:63k8f%}z8qUnTz3˗M/\nuTrg8d5*kg^ii1b@hĪSmg铥Hm5efooڶJgw@\isqRsR9F=|>%T&fq +QK;K݊wϟpX±* k禛7,ǓVSMٽwF/af{d!lv%-"چcčkn14v}   \JO0Z3cˑm]K>|> v7*DiZzs.4x8iQ seu9mZc`U+QVխsv8ʨjg $[WSz,ԟ缙ލ=O;+ݬ<}={KݛtixʂK{X_NGJl]{a%=:&J9^<<>f07B.]Luմgⲻ6Vxr,6v/6oť^>+f %-Vk]`}6FJ֝l/{,(lInE۳P sODz`< {,W|.ݼJ2M;#PG{U)u5 %ݳ|:$ZMVOJ?GޱUVy{IG8t}% A0jugw֑5 Ծ5      zMQNnYXt|UiGz-u|g}8˧)SUZuJ 8~8K#'|>[ಕiskwzy\_#f^z;-dM(F?kG\uZq;ESP2nHKR}V m6(^ba|jt[/@||Cy'Ku]\Ȣ,cDg o:3ne6Ɵy(nug,^=yjcP͚ww,m:NowUw={t (=DIʄ=^mMw+"ቮc._ĩ=pr/ٽ}GGzNnws叚γsh4t>j죫gVmYR0v|SYTq+5c kV=`l lt>-b^vJ-ѣqsV ˬY5vX]h7~čVrNmڵT|w\qNnj0I;$}g:oXNQM} t;`  옟4SqC} MgwokGfÕb7H],rڎsq{v[jpT٘hQ+.Ǜ#įeySyu˻? W9p8tW~'tV^ձO*;$9fXh /emΑIyd6ݺůt Bf7u<ˈ+f&{lf}/+nW,p°^v3VH܍#y,=Y^~%}?_?~3Ml6ʚs]lVP@@@@@@8wަ.bk[IqHK. fo ~\ump=N_fP]'4a)ߒŮC k'gjyl\Y-+}1Ok6Vyr%RnWZj1\}޹1|^*&Ivml|jUqRrɗGAJ7x.ekN >jV^~㋦J6}7J * S5m-8^_ie˔S2"jRn9k^%l]Z4jZsZ졖m@:wN\B9-b( O9_pDZқEƍǩ6*xUEw:4bYY[O"tro͎( %gF9b׶{2~5.oesVOzպ(jžkM~u;YO֏pE "w̎Ӈ0gF?诀I ]NX}N斾?gnknRKͯFTǟ   #>oH$""u҆eT:<jgS]Ϸ_=~="ٛVPjܩ7RnrV⾨ydbw |}yOgR9JCr.HgTlaǃt#7ERWֿ.E:TJ}{'aqyaa >m5RSmc] i&.V;.H.P病zS #8wߘRM"$*mKz%}=Z\r؝]סStSej}1iEJrWQ]]*{-{N~ӑH_vSJя[]UO%JVEq:ЖKv`@oT\wVJM-x?v8&ˌcqxܟeiu$jN=/ꤥUkR(jT>n@@@@@ԟ@@(QKSϊFt%\x|SHM褔aG~O~વm[L4,X;,rʭh_\ޚ/]Y8o])5wYgC.㾧U$g^zI[OÈ_ͮv1):J9,2KkNȮ):+Jt]XMc^RFq,bmQJa0w ek}ԧmm{_1m'+֞A#ofFY*c*]EۇU:>| 6kffxqlp=F-${5mldiE%nz~}+ӕ)v$)ЎM]I%;iP+9     o kĝ;vx@tۨ ⎥vO6/]Uju[4Tg9[$>`uOuKBxboM۫dmś 鍚3 Ku/VywapEpw.iX #Еţ7n~_(I4:s"c%:FWiE.W*w#lr9KY W[21nrs.ƅvU$O݃+9%t*{ak;bc o:a&WPW|}\% Ŭv(]"ųo|Qe?G]7xFspVIYTw1ۛrqeJqEqILF7c573ՠO w}/^N{)F$%MfM-U]+r;sN+?RSKu*_z}VK{[Iq ZG]&0M@oj kR˞Vc&i"=O>GR4\n˿:|+X>kTokN?3]/޹͎(5s͋=;-|ٵ >Qsd*g(elMÚ|5T-uh||k+H)л}ܯU]9ٶi7Rs/m_Y[BJ[g̰;knK:}]uu.B^C@R~wZ4Q*oԇ@hۑ%YZ\N<̮˰jnxM]uu7ߘ6T-re)$LrIɽ\8qmLN;m94+rCk97:eů:mIcu_f!XatjچM:9hy4%(B!DvVJ<5hJJ1i iptHilk{K'ws$2tJ}W߯VIrW35     tu U>ׂ!w_]>пbdmٟµ/W4ُk?_es<|jlvMQOef^'T4rV)%sN9mPִ\W;%)6vK+ey=w?#+kSTi&=0v],:~CM]kYhSi˂cil}Yq{yڮ1OY%.n] js4>$a vŵ6>'MI+gr (+'tyrCepVez-EuیmE|ЖU˻zbO~Vp|:h7QuΆBqkb3yI_FG}\?0sGV3i=F͚(jAb:]/ēbV>6@@@ gu]c8$B7L{ \[ juR %%BIn_Jayiax"ZYR7Rݹ0 zӳ]Ozg٤sִ&3\B'{r w{n~w-Omji:!ugf+=]dƹe1ҊHmZ[rWݕWI;۷1 mt7ח4֋^ÙB-%Gi\拤.-\M;9خebԲ՟]{6߈EVP*nۆ>N5q{%|wlu+c!|Bpz)'|%ز޼<<9Τ(,l2μ7)>WP[     ֟@@[N1Pac(b"&5wh 쳔ے#=_ u5ߟD쒨ۗrq$#4>?Fz9-i'6k>%87厤bwϵrkݔK+ΥHAX[{ݫq/D9yy.V]+T Zz(e'4Jˈ$T}SliA7$jxȉg*%4RDD>tq$ Vk}KWz4k)El۔A+ͭ9jfSQr$[ǀ      1 bk9Aԁzٝo_> 5oem|6bCuZI 7cd4ͥ|^1<-`>7>%a_m~5|bO6x \qm&5ymh޶5oqoж.ԛRthmU&|Kh-pEs}*ud:9+$+lZvXWuLTk:N_;-JzԋEgz|Q@/.+U2}P{FnyI6w>\W;P<>:̨…dՖ]|l\H~RuMuRطe-b -trHSVX\;>etb8 sc@uݩ:nvܗ&ߞEE+=E9)N[~]?C?3+xˆ[흟m0ܲC)I$ksؕ-dԦ?WUy(ȸ>@@@!<'pCGVэf!Gebhk|V'YԊ͝ IkRYqo; SplAsm{ uӚjϙVpRGlߜg|ў7Kw? 9zu+rOy]eRr Zhoȅ m8e׆{#dpKl UĖӰXa. ]f]XۋskjR/7Tm,ɵkp-RY!F7vR\Yq3)%6F纤|q/(:dr-%u2bu/e M5 FCQI%k@$`m?ĺMgtOh)ы-7^olWRlzE&QŇc5 /g l..uFHSXniu+zfG꽗W#OZ[])l'/Z9A*r8Ԍe$ڔB]V |2      ן@@,Gpc͆ ':FO37l[&=iRJ0V[Kacx5di3EFn!_+ь%\jֵ͞YƵIm.lW'KR+ƬS@@@@@@8;_DN~#چTD[ێеh;OZwsv}\VO f{'@V*ʞd\(e{Vw5zivR+ $Al{.al{5hʜ6U B)Fp8(J7qVi5Ztwf8KhwI|eEqTaNQ.gy}S,dln+VVn咽lNj^[xk+7($s_)y.VZJ9{<}=Q^ŶG!2WGMq8pͯwb4z}a#'q<4ҤtHM6ER/u̦hxxo=mήQwNVZ/|i[]NȞs<[ڭ?J.1j Ϝt#3;s\NK,.j-E%dxI#&ce{a.,ω7,[Ge)cJiEk+uUYՍ?y.2T< ⱻb]m۲P{#\{TSk8wJLŋ.O@@@ u[іwl5-fd+3i-:S.kz5G6{fҩJW(I&&%tӳ V"&)U;(z2Jy\Xy<bre4_ůJl[I;w@t7KQJNM)ҫ#vX#*;Ć0,9fWaӔz}8MonTI὾W{ͅf}Drwp8lt:QZ5J~M-^#F4غUi' +ڎ%g)]gRY#Bԅԓi7iG)۳+wʡ95\Eq9UvZ*iyόG`Y$8ֿu1oEw<TyRANwܚT^?"b_M#d?8uQpgҮWgE>6zG3˭ ƚx8dbq5ck loo=]7üFb|KfkAT*A$weI;7`NmN#xSSP1&䎣mWj2T8x5K/zv,{]J/@@@@@ > jfd0I$85cE8W dn,ؿ_K|[-nAIt":AnNZ-pζ6'dﺛyYyUjQWc_soϠؤ-nt4VI5%# {ϓo2[NWq58*=%|uЗ(7.vNwv.9oiӵwkena {92i: IEV ksQ9XQI[ΜϜZu]eyYq7n4ӧ5[S(JV?:35[.[|>/N%$CO+ ໻ѐR-24;V9k*W5:ۼp1s[sf]gR*,/!G>k]x-s8PAI9ukLvy=mo[4z -/=j]/]4)➑+WNwz8G3ULU-8QE/ymIꗵݧi?W6~mܟ3Ҋ};ӓ)o;JgR[uFu5l=˦G}a|@@@@Uhjj1K[:k{ ( vr~ץ55kǩv/[,ql^魫kkQ'*;=Jq{}NU q;Z>|ŚrY76alm3R|qe8d1 wy|9ה,ԭFNMpԧrM;)ˀ5m+4sRbuug<QIݷ?Rt?>%ekplj#ZG=u9IwwovnAj楙ő~ ]>*#(gokܾi%aéNa*]_]js\O>~ϗ qZJg;vjɻ2QRiRctt؅C*)jcdzWD\FJJӵj2' E2M4ӳM[|x&?1/qs<@rFZ㻃Wf۽]bN2V鮧?٧oH%N-ٕa)8؝᜸(;|" 0D0ZKnp6YVJqOKwKхD=:W^vv┬틔l#).͑\m[[RL;kJ4|9ߟdga(U^m$Z7xɉUZJr ˬ|y.#Ҝ_;G}j+-f],vdɱ{4km«f/MsREۅGWAlrvЌwSU&iE$ܛJ7laOUA.O9lJsYI6Bwlm\v!ajIケQGڗ^{Lbѧҡ 4V)I}ۨoKwyry       & Cz3?pK+]Kl镶&z=&N)ϳx6L8nQN6>^w~[NCN~<2u{6O8oH^4[k⮬Q$dr63%;,=y:= _b*Vomiǩ:MGGXMoS}\+ ?1ںj%|Gff_Rfږ2=WŝmLoNEwu]nd{oѝJmdl塚4w;}VU㓪8;4ݣ'o$=s”`,'_v[̸ =.WI[ >ʎ*7)&I61ʬdH:@EOTֺ%e6'?EFqj\Usr+5rەsY%{{V0_eK}d[vxst\hz*98pK%BD^33vƼ|NW#[liq#JZ&A:rwZvCmvc6qػ7i?TOg>Z5]-Ov8ޤbzqqVgY@ X>?P@@@@@@ҟ@@{s<YoMoF;ELɦ}-d] {s;\>sog4 bvkg[F7g(ˢ*ءVfT_g{-BʹNi_vWяkZe'.r|2EVu>zP{ݮ#[6/eO%޿4IQ ZMEZ3o-6Zu_ʓ~KpO߿ ,KU+PIIESnkN60Pt<3bd9#!;`vךJkٞynf'қD譝ը)o*N5-.}fj@     l1q*i)_,<1hIs'AjuU^ P)I9IJ"%}f}p&X8VYhp[Q;=o;V-\Խ._}Q$Mm]!΢,Jtc9I^#kńَz4zK#b^+TN䛋up%g?RsB^W"jG[`qSƞd}<V."vH=7pȪZ5M ;C= OX$eWWX6c&dиHk+y-ޤi->/xW=wm2sɭ1WFXlŶހ]S}hiy:k @繁9r6uU8c5TӪ庯#{!299x*fk(:fv/D]g1bxIݐ^aq *' XYpURzdcݦ]mnRh7#k #;>$߸-/n6yρN3Xݚy]u_)VJNW~ [v慎fxv5v8uo6um Ll{=!/vj|w l&}ZQMnRSqL5nYoG)}(h ZW]~ޙâװVv:n*J?E+'qtmj};IcIEb5'Tڱ{O-osIWA9,@d.aS֬w6I{iɆ=uW)FI[ pv]hser~*8v]+KƝkخw-ckF̺FM[-^JV֍t2<#3i6ZT+:1V]~$՟47KQ01&n$9lEew;O]Wy}J|RmԢOE )~hJU0J:j6H{. MM]e3:JN2N2iifyM=S+W'r     ӟ@@DC`H/( q,r}6;'W$.y>FۿE/D?Pao7Bp]Gַ^Ut/!:ܼv?J{v]w). _힓*iBYkhJ$HzaJUEœ;4Tp:h-.w%JZ䥹ٱ]!SYm=RxQ\--N_}Ks/u;K6 4HǪ]3ȖQ19^7X; V̴ #kڮh*NfQRkrEm |k|K}cJpi*`{4ٯ9 E7->(Tmu&MتFjI7NT'S'kŴzjCRя[F|HRyw=z|Qn'iuK ]_B,>XkZpqv|8.;ɻ*12VM<=My-KlAQoppuuoQԼOm{h4*[Ӯ UeEڂǞ$\+zGDq{a6͡OBVт-=E]3jU#.!]T&*8~=eԖ>q_٣vIYsoݿqL-7Eg`bS\{u>_bΤ:YV%eeu5eh$"^ًP4k^kxá w.ig5'zht*}B)+٭i46U"    ԟ@@½#q'8ᴲϯxoykG\7cgzjGcSh qy+I^|lW7븎ZIt8JPvW-ͦݸ%~=z]t)œEB=Io&tQH 6ezE[ǸEGH%3Nqv;S 5%. :]Cnjws.);dͨ\ ρ9h6kl7 ]ǁOI-U'.y;c"8.d~Zs#ic# k9>ϑ٤ix]r5XmGbvzb+r6L"w5     ޳sUug tVbreC/Ҋ8pqqo)6ǻ-&r>+~B;fڧ꥚taxqOߔrjѷ5vc)D98>iGq%q;MWC?\ t/Tz::jIEpKE،:.폷UR4xpzVͱ(WvyǢJ*)-s]m@[֪_U'FK}ho^QnEaZIŴ])N7r4,SF5Cu瞶LÚ.t/t_-,m͍6$9?XUaq,㼌f{[Ew?[w=>G0G,- }rmx~&Cgk|d&^[VV,(ҧ6|Jd6Mkm9haQڹ6Pq˚mK66u٥l2BYѵk$6话Qp^ԝJQfzJl }[RPUIS^.v3 A_[5nEUv`%;;}4ūx-60~S9cr!0?\n卭';}瑭oҧ'ZbnEQ-rGLSZ"dUXָ     +e-tbeUW:օi}O>:2/C´t攟:oXjD@@@@@(;38aSZFrYю3=Pٳzic/# uZzIke2Ayyq%7I%\A>pYM[6,:JQI(*XTTWTRI. "Nqu(2Zj[ WC-E.2KmYȬ C 4=eкz.N27oJYi or4UcQ->'ZWv}Fb{NDL ENSu&f Iv89#}z>hi#ZZ3~5r))]eO>~a)JSO-|oqzp-O0ʸqC15x=K\ :mjN];ыhrުWꪺV-uc,&Ӽm[Ir`D{b6SJ?AQ&KŒKa9>RʘXCsA#1sPqykuS CatFi!VjIt'_۞\ yh5lw5     r'0#F-gmMU h6/iHY/t}ݍ^lM_%u{8՚l]$@LTϙqlX}Mar Yi2_CTKtjsNerUPֻCUHw&;=%wXfxq6מd?RV>\¾rV*[KȨo_y^ѵ MFkgmn()(*:Ҿ"Ʋ7EMA[Vz[Nof>ը*otoZ.dS68g[[wE:C*IV'9ݶ+ SOvqWDK֞ΟI J6x-=Ie:~'_n?dҭV춚 NM)B65 r)47*Wvۜ,)FEe{ClG}W0861mWFYKّREG, hga7Փun ʞLĩQ)s̎ (k}=NRTS*ؐ)X]G1V:؋{ l׼zD~7Ƽ/7nL;@]t[M?YmdM_b%hN-%n#04@ @@@@@ן@@#+ )sϖzș.-3Nڲt/3Ya;.oR]nѿt}~fjkޯ7<;sg$Ⴞ{׵~U-Տħt6ɱP C IV 9  ߞ֛SKr ˿yڵ4h5%Qsgh]DƇY]y_GW•KEd 1aU @ i/cIr*YD k:/g۶U*vm4yJoka<:r7y,mI&wQ_^J9.u٧tR'uV|e=<- dq4<"V>GQIۻmݷ\     pw'R,3dձMČ1G!&97P=~qeE=KP5) g{me33J)Fv{^޽Ƚky|WR]~[&Qr=jҤQ쒧$z0]%p8H%I_` @ 3M[9ӕshӴz%. ~.&]  g b*iZZ`pZ;h h5:rq]ԢiM pSGVNɮ gr=%n7}CS:"Ur'Ӝ_]o8t) m45:YM-jF*Kյ/an潡 A.KkC    QO\RA?wUEpn DŽ[|87^30ZN0lKF7.pWkcJ+쯎_rfBY׹3}+Zk9)Ւ٧!7$m=@iʺU!Wۿ^1Oq!Q-GO_ҋbzBJ~ԭͫkFfof0(gX?][* J~-Jɟޔ'z*im[63[8@~n!N< w*Ü_ddj?2{HZ/~dsn(f_ffi~C~ f#  ppð$pm,eTOjƲ/eHB%R,[>rVFR.ՔZu{7r_%bIc. )ph# \|MӨlUw>.6ڻmIU9Tr)ɷMY*e2@;vk`gO!Upן< ~톾^3Kμ^d;[˙US{+"Сϗ/>٪eycʒnxJ{7{NZK42SSF-="yZ Do ssms[Yr]     џ@@f<xc3=o;<'5G^QdsVŶSf_Fll]Jm-PsI> s|8D[+e0|mG/N @Zɶ{[ݜ),'TXxϞ Xb6UD|N|TNQjr12JGb;r-*q<"T]-zB5g{%qmU[8sBm6dE(aa5wЎ{kVV}^?- IѼm<ޢp,ϙZmS)o]>c*m5:;Mx        `= aZkY]jH : v= OM6CtkݫNU)6_']9lCLCi=ex>kmpy)%W- z#%i%NoǓMpi. 3[χ##}Hl75k$/h."ڷISqw|dz7F+1 C:N6,vҔ^)#ՙ@@@@@@@@@@@ҟ@@:p3f&cC4WdeLKZ8-q"fKG[>ywFi ;'{Iqf{ڃnJSB!g+ŷ I9EN2AOz$}ª9D_{6M3/M57{)~_{ 쌲,sHo;i.hӾ]={Nvy<=?H         G7ǫ-gxӅ F# x4B嗀̑N`ЁmsNx1O#oz+R[&jzwjMQ.׺vlY 6V;,8dsO0C*G\u*FQkg]BJq$FQZmgSoA~Fx躷qIm*JϷ>#%$=gWw;S_7Y(dNyGUbu'h _OomJuVͮ_9guq^7Kz]trРݪ֌d.LW?P_ǽ$R}á ,#WPC#gV^PN{=7Mi]8iI ُEu>!U$cӖЮ^'w)Ɣe%{M)%}اi)lQB,1h`XX ϊUnwV鬥E7Ke޼i+'+h֯NkC@X V'Χ         j6#^f.312iWʞ.!^P~d}%zdZUgM>$c\x.5Y*jqm#WЬ٭,5KtUU>S>}$8>}? NSU6ͪiꥴ֒sfp<7S}=#hd,`XNnz]Ԕmt]B            ԟ@@@@@@@@@@@@@@@@@@@@@@@@@@՟@@@@@@@@@@@@@@@@@@@@@@@@@@֟@@@@@@@@@@@@@@@@@@@@@@@@@@ן@@@@@@@@@@@@@@@@@@@@@@@@@@ endstream endobj 15 0 obj <> endobj 16 0 obj <> endobj 19 0 obj <> endobj 20 0 obj <>stream }yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg}yg endstream endobj 21 0 obj <>stream ˿˿˾˾˾˾˾ʾʾʾɽɽȽȽǼƼŻĻûº|zwu~r}o|l~zi}yg endstream endobj 22 0 obj <>stream ˿˿˿˾˾˾˾˾˾˾ʾʾʾʾʾʾɾɽɽɽȽȽȽǽǼǼƼƼżŻĻĻûûºº endstream endobj 23 0 obj <>stream }zxu~r}o|m{j~yg}ye|xbzw`yv]xu[wtXvsVurSsqQrpNqoLpnJomHnlFmkDljBki@jg>if<he:~gd8|ec6{db4yca2xb`1wa_/v`^-t_],s^\*q][(p\Z'o[Y%mZX$lYV"jWU hUTgTSeSR endstream endobj 18 0 obj <> endobj 24 0 obj <>stream M9= M9= M9= M9= M9= M9= M9= M9= M:= N:= N:= N:> N:> N:> N:> O;> O;> O;? O;? O;? PB S>B S>B T?C T?C T?C U@C U@D VAD VAD WAEWBEXBEXCFYCFYDFZDG[EG[EH\FI\FI]GI]GJ^HJ^HK_IK_IL`JM`JMaKNaKNbLNbLOcMOcMP endstream endobj 25 0 obj <>stream                         !"$%') *!+"- #/!%0"&2$'4&)7(+8),:+.<,/>.1@/2B04D26F47I69K8;M9= endstream endobj 26 0 obj <>stream                  "#%&() *!,"- #/!$0"%2$'4&)6(*8)+9*-;,.=-/?.1@/2B13D25F46H68J7:L8;N:< O;> Q=? S>A U@B VAD YCE[EG endstream endobj 10 0 obj <> endobj 11 0 obj <> endobj 12 0 obj <> endobj 13 0 obj <> endobj 14 0 obj <> endobj 32 0 obj <> endobj 33 0 obj <>stream HW T ky/3,"(F7 a}P@"ThR-1Ԛ&6j4]|$YVbMGi|J'=ZOsj<g i{wq8['^][^]x>Pvum+Z݅v6αXq=_P&t(o M-kn% Q |&E7 ӠYC$u2B>FDEiSRui73Lceg[rry &N**6k9s+ϛ`ùh'B -[^иy%|`UֶY۾)Xgq;7nyNG?vn^|i_~_v~o|k>ۮǎxw='S}Ù?8/]?r (a6 0I.N줎'ȋ,=Goq~$' IN BP$zGIz>KV`+مH&t`lgp*i &3A4YafQLDx,ZS$⻊,won,t(C \atkq=ɍז)A skc)Ljz\UT*×h1UP>AA+9r3G/.$ نkrrD1>1"`9]o:;i>߿XpwXp5H4BK-Y*MtK73rFeLƎ*cY /R^b^tR^&hh"lT'bbզlj48a#D~[}6S~ <9d,Yk{!ON0ybDsbFnrxlR2*$'͓>3~Rzҳs+ pW-f^zVxhv#eDd 0-K91`hIw ' )NG;=9"]#z%,뚘< \¿߹?vӝ׉ǧ޻4ajDsκ 7˻LMk}e|f[3ǖC֯5 {qpe,y#EPcQ&SJNB5>58߂re4> e42,`S3R;tF?yr3!W6Y8x1\ bp/EbfJ g)L#eZBwF+1+(EA{S9:1 >r7zzswhDmk-ZDA@(- ZA1}8HDHhsg_xhC &ȏPG }$E)8qY_kU붶KGyE/سE|ߓlgiw==E$)ͼ&k5P_HXCR@JI\:c"5Ie3 {¢ د{6!o5fPAW9n{jv< uPĚ'tW5Wxɞ#Nz},_jb^ɛM>/ך}^'^Ir&Fޗ}^Mo1"Iϗ;*9Q!>͙K||ĢlYߡU j&{BgO:p,|~2j9?1jx<ű`/8Uzd7}} ~Rznז B gK8B|(%8Դ"|YV<} v>mpQ;0#N{[ ᑼ<-^MڢZ`S37SA tscJf2Glsy$WaO9V76\Ӯ7GU0?7Zcę ET_c"ȸ7znT 1PA~)4#Rq4-Dpi?^r0FЁq 9i-sL,3 =Ÿ9==jO$&8 g׺iR絕(bLģ\ 0kSs\bH!3_@'׈B#.:⸎R6EIfu=<+>T[GPYZ㍧ N~ȔTʙ}͹8C%;ۿ 0X?" endstream endobj 31 0 obj <> endobj 34 0 obj <>stream H TTWׯFQĭnxh㸍::N&($QADAPqMTc n+]QQ\6Fmm}_A@F4mf4)YyyB~VoݦmбC?aXݺ^/_F>E8(*c7<~DBȤQǤ7~I_~5yԯ6m.}fƬgΙ;o/+VfZf6J6oٺmv)ػocO pWx5e3m)E$ rUR>Bn"ϑ Ll00BK03V`JM(UDT* rSyT r-jr\TkXM._ˬ!WOkl1U yMN} rZAGAS Xk 2J \7E. *qUT Z!#K«baE⬜#K-''su pwsu:k;}g-SrxP6N+{u+l|ywW^^6(/XyNHlҼ,G#1p- tr ^+G#jhooocoeon؛=ݳmm-fm=9Oǂ\(qR%^ܕrgk?!ż`sA)J䋮.BgDNb7カ]04z#B )_&5C[Wgx0K~raHކ8G9:SV! Ӥ}Llrj!]`0 1H|_`6_x& l` Cp88(9 ( ce\B N|x $"#$B2Fc "000_b2`*xr,ZH:HO2\ERTnZFilʡZd M /35Q 6fB[imJvS>:Q]z2ܢԀ Aa:B?P 5VlԄ1jJH&:N' m!T2N):Mg,9:OALYED%tzS =<3x9\ygB^$b^r^+9s8Wj^ky>^?x=o7x;KOݜ{> !>G>8|O>E|.W+Uz d,zYYZA|K _k#_lc;dr|=?QO~LWBsyFgYd;ߝ3RBIB $@ ؐ#kúTKswEATDUVQi"w^ }9gs<WS%hllتM5lM[˦4nk Id,qrXQ9&儜SrZθ+u7-Wmwu>ʃcLemgsmfJj_cX}Î;NvjviK,; v`g[mv]j߶{}P;8hw{v]a߷+C]e?'v]kI5IRCjJ-I4Iڒ!udJdKN$6ZFӣԊZSjN=uԉ:SJݨS*ԋzSK? h 9ROr%O4R rVyi$Ҙ4N3h&,Msh.ͣޢzcTuQ]RuE]U Un[Lru[QwU~ZD b`Cꃀ !! U UTCUU@u5BZlS"PT!Q.dBdCԃ\ȓ&T9(\C}h A!4&f#mWx5cuxO0&&6Jh;B;WIh7:H0t :I4,t.%LW|KJ:ݠRI &$*ۘItb2V*X*8`ŀ05ٰeb搅]X5f䨩ƞ+qc: I̕ WjչZiε9xÙٜ88b&ܐ rcnMn^0?G6rEr[n'>ܑ;qg]qwܓ{qo㽯|<~ܟc<`~'y?Ox(?#xs/pUMl}|$\n+.[Pp]ЁV18s0 >n c/p >O0|_‘:G iղC->flYJ.Uq]pY.|W殅{صr\'>n솸n{Vj>ETauDUǸ" BBX mH!a( }X) Ä01L qu"v#V+*d";W)d쑽p~lVdA5 ߪ`m| tDGEU$ j&?螺8VH\WE f%^ +මnoʾ`Ap>o,(Q#jJ,5*zE>ͧ>u}>}w>o |#_􅾱;.ff|/|)_kF#l` a lm~p8 8p NG?N麶ΈS]Ex4v7?fM8GD3f6,Id0ː@Y A$$1,lvy. $ (HP!BEhF~ۏZH";&D?u̹ǹι爑bJ vkyBDlY1Vd1N \W/+W@}p?Z6%<vsV9-d"F"\_fB`nDZޭd(bKS|<e/tBb^sF͋K[}sV&$+=DKITDUo&RiZ6R,l1vqQ̒`:4f#rf˨ȵ4f _Vs| :"5oR_r SX@U#ƈ3l[C*Gv ͯ!@;I*v].d(eiobbl*w*UfNr̺žC'ct/BY4iMDnLh)&~|b7b%VɁ}Q6UBڽ7"7Py~QaD8b/owDΚ8t!r7q$#Cx=p[ڏlfe컬5&N'E>WERqLNA)ɵ@&b$y+WfJ59dy-IbSt3ySSȧaVhm+EpaL~, 8D[8xxG5|W>BY|6:e:t1E(aŬxvl >wtEX8AF|"|[.},0 Eڑ^{l,TXV!#߈ d/T/a3 ZKGi V#VPLd2Un"2bs.?E˨CDTX,`ZIA=&»5 x*ðE ZE%<.'$T^8* ^H)9+\H d6b}=MغJZBCa9 ;a~Nct *ʯ),L4lwS*V&h\d&o6b {Jͽ0f:~E6m.Nb+H=4lx++&{&]71w;d3ڝ52=m>ܩ zǐTGJrAO'Ʀ*RpFY>Ҍ!iV]FCm !CCwC Ei{z{ӓ%hT|fZ+SHjƕ(]qN |uEB?R0]s_WYl /(#I_̒ YIfN1qpE>#E/$0DƘ]:Aw S~hF1Ta.[MZsV[xskbkꪀ!]XHzo|7t;7U}U 4ǥ۹N biP؏7CVÒkW]}VKA3SpCGTy1ϒç+Ә4pي_xwVsB.6&bn'j{xQ*ݢz4,- I@ǞrWm.~AQF N vk%Z:˽[[ԴdNz-pL "6/2FYr]_l:7w:K]u$W!vXiqV @r 18D#&/a@_]vm\/.|Pn+zպ=n TMTU=J ֐iQP״bh FBhZ;hw:Af5*vXFw=WxaqUW xZׂӻ?@IRQkW,*jiU_š*ix`ICd3nM;<+mXm%E0 pb%aIYrF`{!{[a&3."!kۣ`Ʃa|X<Ϯ$RZon KYfna2g)I; ͅRh-n}`$0w6y@~8a_\PND"H+(nȷ 49gy}q뛔Tc[c[(F-3 V[SP<(U!,-j8\ ~5bE^tA x@zF0aF(Gߙa&g+v+8%G JNy~Ō }(fyp[+n]ʑ];|%"4166T~v5>ӽw@9/?dWIPݏa3+ .J\pQ G: t^НhԷ ˄GM(F' b4>88MۉQmB ۈMGjiId$pU¼<3%^TZy t^/R֑;{woy ?ڳk6u}}4}kcmη^E7ȇ2-㹐!RBHꕭ}{8.LreMB(j~H'.wnE/±Fww]ro~'ov~OO=޾a~~7<ĤA1m=5@8Jiq+ 3uAb4* "D˔RPth^/'_.2rAI1ǧDYFcކ8mH _GEQ35BVpYdl6^q꼒&¿.jCŎR3nb^23`Φs+3^2P Qq4ų^ vp`$i9O!xg3R* m 9BDCyl(= ܾ,'l"nGE0L@N.,B_z ZWTD/":_xy J}yO~YVwSLx[M-^ێ۽cMmct/}]yGGN%7鷂l8J$GZeSEB.JQZajiQ0n.7q+B!{rZL=D =KA<;ܒ+!o̤1\$JM/ \s'ߖ^kON{s/%ZdE[$$M?o>tԘے~T{8VGEꫨg<Nj39FfC^^iʝ)YL8{C{QPLj7I$1-l|d{JLq:-6|'-mےSvzX;XW.CC^/xFq]wޏ]^l{Y)OFAd Uʣ^aAP{+t?X3ߏVџD.Iz&pER~˂[nbe=Vo)'n7ܝBAb'1@+z@eVr. )F IbqM'Cd;|`~s!'d-yxs#ȟ&'k0O jy&ԲAEtJH] 6"{ e~I +YEe»Y%1f52 d G76 DŽ@CwA TM 5JVo +Ji~YD%EV%IxFj\}K(%KiQ5M)й9Hj9@8ҍ8? ևR<J1V: 482Wvْ 4Z} o21n{8Vm,fo`賁@C5#/0-b[e !q/z&'CM*Θ4^]|ᅍa-#\5B:uK µ5ڬk%2vNmΕ]ZUkk͛]neо難CT|/@*xr^EfX0]W ٺ9Ǖʪ&c۴%cOfJ_pYZ7͝f6_p\̸x&>SDf2fJQVDfݷq_SfL^ZΚY*Ð(^*|R@5fޒE0qvI6$>49Ht̉RTCjJB =htqjp SQ=Ym'jWL 3u\H>yL:-ј.Qɇg$&%\J Ԙ^% ,4iJI0&)t k%nE~Xg}8Oa=0c{zPC3h93h v )^M !Hlëqv? M3o~/-T;q4j?3ƵV:U3?xi |+=,O륶)RuԪ_?ζc5mj[\9) wRlgb{/FcD):=!+&M-k sJεԝ <^еҽ..<`\/ݶo>/+Bq]kݎ8ϽP|VXp2,)HD%h "W1p'[ߢ 1WVg3#qul:õ3"\{G@4$X=0c 53 |C"{HCi'_crD8a#L/B0|E6jG87ǑPŬZ@O"A9멜Z[܄Dg6oxfkhf>|MTzgO6ʟ}~lS'Ϝ8[X &?٠ePeV1l<@Q(:suVbs7/+0%L60a2+S`56!R >Zl]m僚7]X VUj9ck=:2fb{{wT70]`xQ9[F@2x9ܔr^dXJ4gBcAr8L8LLf"apf3D n~=?;LbrLe)C &rHf*dr&t0O CSjH]Q\Wx̝;zz1kc^VaQ˛n>0BNL$B6H)I`P~TH&MT')T5-,:`{xT{̝ٽ;w·̪h6ȤJ+F5qAxIj/SRP長{o~so}<{r7^{z H)%ڛD~poɆ?kN#ϥ\s,9Ǽ5i=ߧ˵vmbX[dߟxH|P^V͉y'AfA 8}3Mg z2m~^3H*2IT* לj \t;DD1mLJLiiyVfq] $XXA,BU8Z`J_f$0fC c6ǩ&m•cjzVV)|" c|^a`#1gbcr F) vt'&&P& M޷+M-6^fߖiOٲ㧚>Pٛ[c>ډӅ3ĢF1|8{Tټ"J&DwMr[\#mQhJF[Qi_A{ N'&%fg$W%0@b-: C u8FGrnM$4U8*,)({P{"\\߭xp yN͝%XbչN$?;AIt6/rj|15uzs} P6 kEw})3w <@ \PC-y O!- C[M9=IU`s#}h/޼Bΐ"r3w CS>d$y 7vudϳ3퇚&$c3b&y_^_q}lOJ2;B%EmbGp#u1pq3ݐbRA_$Óen<`o9{GxYcBvl]7 w ~? z}űQ!% M(8[X7˛yd&ߜ q[|g>٦0U dR]U$*Mt: 2[ﴷGOmdEHղ!׸,+{n̻Bgke;Ls Jc`-6KuA?Ѣ {臭S;ۑURuUӳTC﫫Sm /˯TZDuODT,fp76[8-p'#zHZDHs5@6 0tqi6m.rH%YTcؽ.5pj5<,p}[ ial)ɔdJ;fga&|i༁Zm G81V7l6Lvs 936M[(H߁M2]quw\vrp%7^LK8*88AЄB  "1 GGGB+r!J!ѨI8*88#+C \yD>:X'fgY?SdYk:dždW(1EU "+TSԴ,vA;i7=GnOERꉰOPB!z|N R ol*ojHmMTx_\ҊRtO+a&Bab+8#16Re% "bEf?`τ.İRIrÕ9-?eH4Q(2͢rZK[=,mz(~+j:PLe BY`evR DS._+aM%2',HDiZlY47 NVAc2\8k(C7fbo͛ nb"[L "N8)⤘&ӅRvoJ"Q 5XH{jхHn 427u\Lɒ m5Ocqqڃ={{>M6}%Xl ج%%vx$-CAM J "tՁL0(ؑv:_t;da;TNFf}>6»N5^4нn#Aw3Z&RtAgà$TJ+uҰ$Һ[jNXr"4Α# RIݹyݩ(;܄-Su(ݵUi??aXyCsi2 *Z%Ȁ@[rs`p(c@c@ˏALB, 0z,͗ˈKGOYfz)v rȩd F&1Eд!f4 &h4y ԁLaQUfO666b3 ~OG 0+KSSx] .!_Ɂ hyYڴn\I]Lg&kTM>Q%撼4:u+9hh-i\ E'=ʆu!A_E'BKˊMV|ftV_q Њ[MbvkSP5O5m=[vg1Eۘ5finF$Wb0Kqša kc0kk6Vj{W[>bn,Ԑnf;Ni$NEw;[G@@DBnyƶdSQGd#k~`Q0_i;:Bw>hClƪbv۾+f{nh7;u)WjʼoElxKWpkAӧ3O_;ޜlFKŚjImʣF{z%FWZbDY-S˅RuFEI*v[6Ci'pP:ilc`pL!4ә<'<2 ԭx*7b?ŏBhiN 9討rT%g>t:0&ӱnqlYn|P]NcVH}pN c7 Bd\eX!Y!c< r*ɅVW/J߁ ޴Щk/8Wv:~)|)~11RbQiiLcv`h_ˡ^Y~ǘ bL1D%b,=Cͫu@Y$P"!@]|u >eY I!z>| pv 4D dA0+ A&!`*<ՂSQç !mB=q .zbywJ߸i77й³ ~g7-tHG~8ڮg>4gO+Bpnpdm~ | .7Gc-q)9))\΢l|UmzmoпOe /\Vyr\dGc|CW@|`Q`]@5qd<>FS@L0P9 ;C'zLDM$Ls3+i6n^Eoඞ$:h:xOUnj8T[BDSuz (Uw uU{Y{'g{aM' ;uy=H(/!'sů=^ūB/p#rRKDdqqJmƽC7KJf9".58hic@kD7vXyW#H(JRRup·:>ФI M{7/Z9t>s&_c Sc5Y2 H1d d8٤TH.M~W٤zO1-uG%qDۼmJڦmNoҩvjz?_ΦӣL/PkKKjzR=u韨зl:f}WcYuIR (^Af/%jޝ׽;]vwvX?6N5ƍSO^2 L(/7m@$4U)sRjΰMDvS@o.‹kzK՞U\?o)f Z-:YH't)$IhL"-8|#őswM"[-{)&Uhb$ I tjCn \ٳJQyqw !3 ovH ;@#Qפ&x&ܘhs9. vS46YXh[+ZIɑzm)C3oJκK{"@8Nc!ju^{_:xvw|jS῾nG?SĞ)S|ЪmOoˬټ6!=y?{k5VT"iZ?A̹[ADQuUiR%CP4FR./9P,Zߢ'"'&Ӎ[] sy ε1lz*HDt)xZ5Gb@?'օ"e&7eD>D4kn @:u27XrDo}]K/ξrIvYJ L MeON:R6I8GRU]Լ.M2iYNR}ܣ48nRZWz^"M#IE6qҨH-ܲ4=UY l+Y+NXv.dMJSҔHjX{rv?~5{⥻Vr޼l1+D𪌚/KI:XU.Kh3vaZ504 rCLmW;J'݋!pS*%^@H^k?zr;2i#o,I ]^&y0Kr2 ulo[vc;Gҽlt={^?bC䯉Ȼ,9 3I%!)FZD$j*lN&a=t:'t0Ȁ{פ]Wq| |'K%/!0 \$9$0$00.xPäf!ጟPQ ^,Ĵóa$pCUK?ma:m oUv%R=.Jpk_.3&n=޶sH44d>:AH5q_jML0`j m )k%zDZMZLxr\B.'jh5-tx)~D}*T I+tIN/]BG=%BLEZ1byy387fr\؁s(1ŚL ۗQxU19鞟t?-Mbb" !?.Ib6y/{1\3(To(5_ˊfは*D~WZ?f<4hibM;<4]V۰Xyh=qN*/4 j3sw뻻^`RܒPie~sqw<̜朙gwJgJ->BQ'^ Oþ*0yȌԯ_/'}R)&_hid~(`cE x|7n z ^'EC4K] ̏]nu /ẇwز)#+LR2EBo +VD'Kv.'1ºсOB|啾R}K׹U5D@i;d%Ib65%}Ŧ!XL3{$O܈}|xj̞ښdO¸ .-vհG+PѬ$nKVtU PC3\qX-Kc]p/w\ɵY(Ƚࠧz$, QߨPY=/U/,NYvC/&\/wOP2jnKῶsyœwۓϚDҐў|&~w3'D8Ȯ'=Is_mMh{mp<9U$mhz pxu' @0ڀF` 0blq p{6fְ̙y)F%\'?/ˡn~8gw/:9%ΞAp++Üyhfsȫ;͜|~Y¹g•5ZH.7ge9:OM&{֐›ϗdPA{PAv<.&z[-n{{væ<ݬMϼ^g7䃠3u\r _?zgONLn*8+Q~<,hH|s)y{/A@K@!T+5)B@Q$6RҏZ Vb+B)*@VԩڪV:lg~L1wޛ<6=og9+r0d|Ѽ9 +E2 v')sr\.W;s})Rc~S)#!h<>Gsg07hngig~J[9Ŏk|1Rƙ+/cIutQ{Of UMm =ub?d՚So 2Q>=?Υ^y4ÿjoc6VZfh]Ak4|,; G0EHo %ERDc/6_Ho:rJ%~)6ץFJCѽϹG'vpsHWkP*k_Z *"}ىcJgZ"ú3U zb<*Ъt : *|Dn|#6#_"_:ְ~=?~ RI-!k=D elV[$N2Cp~qv3~@ױ%Zh%]*Ruk)"r%g ťhCl!VĹ~Hޥ>3t 4bJ)sv{P;yϕf^lm382Ne efHJrU7.hb]e͈}p!/<_<FG ~Q7ZFDU:ݧ;ymy>˕RK&ŭK;sOv꒸zP [qݩw mpqyڬlC4?Qt|&9I1@Y!J,-L;ϼgQә?~Y3Qz 0#kC2n\S2;#{\ڹTvy.++}L'_~`_#nv}YOK;vwY{^fCRȃU.;RV@-}51=EfGrXYn|X4;9}2L1PFi#a,˗WyV}6ʊ.[dEN̖FY?!H?,O.}GW5'St?g.ݚ7E&Ξ7SF.=3YmC_5|Av5߆R9R`g])2ɿ{t rlBƮ-\KKGP\\t-"ԯ/T$?uY;g8W?xE21|HT>P |,fj9 qqcR31 ycS! ,{.\~wcBL)d{!?o]d=vJ˽NʿXr+bݢ闤,]vF)~yXw6{WξJWV(`{b?J]>E R} 7^up,໛-ۨrg71q. = ]./Zw4ʚ,f1-5̱[90Cy6Ucʅ*/qA;:z@O`xOֹ} ~k{lm"?' H/&/QèOa b^0> ȿFf+lx`1\\:6pnK4gfc89;N,k8[cor ,o^4o6p= ' ["/5ˉDPswp. Tw'?{lWǿsmVm ׀P\Ze6Z)0t{[(b[d¢ %] n^Fl e"ehd#fQ6.9yyBk4q|99<9{D7U ~ ' J/l|,{0}x"-JEs1TH ߔXܵ9~:y9';:lC|&Vf-ESpc=ƫ`>Ay| "H]`lV~{ΡWZ꺓;Z^X.kv?rLQcx'0̦uyS7Nw/ PEר-LĖ)?/L[bwov`J۸?CZXG5xVJLzC;'{(sw;ZY30YwCg&L]Q|TKTFp"DuK%FRV?f9_'r&3?%jk&_FLp~=篤O_M-@5cZE?S8D'mRk [v^_W{/|_jz߰έB w$uN ww.o版&Rt1@U{X(rӏ3['}Rt?b:N^uҖ> 8٨u`[$N.˿JΣB撧 '>q=HCF8xҿA~^EnW5DW*Sщn%`r_D!x>[gMRHzۧ9kJ- D"nc9{LOS1vzk'wkHC%}CL7gx:[F iyMNS>^"'S)$ދ'Hoyg.ynz0@p=o_{ mA~:oGHw{N[$o=}oD#O`\i FDSE|vnFA' CȽGݯC2W$F^]/V4=\ڋΧߛ$(qJEn72LYvRlg8eS>Y.ş1jAy%< G4sQ#'/]AіZؗb۞.4m6Cwd;Nbo0П{0\?+|.Η'qRh5$Z SǢ.QzQqZCHӜΚ+COmr|Ϻz}WZ=|M!9-``h!P|H`Dg`$w.<0srDyL~ rbX,bX,bX,bX,bX,bX,b:?1O#ـ/3tƏB_I7i bӽM:Dq5^I'+qԤI,dz9M:`Ф9g<  C1:,#xU8Ꙗ*תCK -`F4\5m5ko5Ke[[TF_uc1PqƲ'Y289saurjݲW'/j[6$YdIrF킅  +SCOQ1jԙmI6$UUu57pnc *Y^2fz**kU>9K` nw3<.8p{o?&3q뚵s&=n' l{G&H KFT{-R4&J$ub*jy٫MQ#%M;]]>y;{jRޖwKva5 p,ȇ` \mU LY+R8JxR=e 0f_xf3Q1z}{p&DhQ׎x>'dvx==߱x⾺6H\d?KٯH%\0_ɘRԪ'f%(nZ^S[HW2 aO .1~}Le >":s~CHOA Y 6@bw%Pw k #& Vlhl n@fo;e7GMGoH=f¿w¿ _co8QkP'8&oG!RkX-2Nm)F e"$I+Kw%DOQ> endobj 35 0 obj <>stream HU p~%˒,[ݕe[!˲>!c$a`bJI& ID2mI8 9!3vti@V߮$4Sy{~ `иV8#7p,]>ph])&-Q:n|uҵ~˺T{H(;;Oƀ0s !͎gзWmVi@R k<@˩S~vC{_K1d|p(\~+|[RB @& u|"-{u'3a?2fjh=)FьD**qx&!q6I7Y7e3-ܼ֜|[QS\RZV^1][7~~Â-ZҺd2w+V־fmG纮^x`}߆omztxl޲u;۵{'={Oށg>~^~G#[?9zwzg?/c'Oק'~ߝy_xt+O> 9\:J 8؉u5(jBfR穛N &}`gzl&[G9x>z|ie >2U!Dѯ@OdTы52!=t;t+t3t=tk0S\wJ0.['n5Our`]&L5?Zew%ױZV(V͢5s<5RX.Z˿wE ]3| Q,Ͱ7ang0a=Al~X w ?6(ICi Ż/%qi'd pA ЫWlmOСr1`Тs:?mkulw{13.t6-|z80mvz%8"BoWD@ n.`tf6+^DZFm^%fgrZѐQZ!>_ģ29gIĈ \ R3g␇׍1 Z<ȄaC }E=G}Zȁq= !&'qР)z5| ! ($1H~ dhpdW>JqIF2l;UTeT9)ʧh>_0*0bTioN[[xavdg8즾0mYZTs_]p,bq+UK*eXEy?68dpF#87OpV} )8,"$ᖜQi4 ܰ4cqDTT"H0sNCԈAB>~gv]?w{3s3s.("3ưn%;g-b+(Od9lYq})Wܢ,>!oRlS2C9__ғ/m!90g{$'ޯ2l4\ɩ?i1`I^y03ιmK-Zi^@Rͫ=܋{\;ك:J2_Q5ױtB*^9(P. @r~䫺 D9=X %^܍T؜J*/y)10c I1*Q3"I_L\niEL=C|Rp H.oTS'@PP;C] Fϗ92nȸU9l,7dܐao,oDTEJ>pХ6|qV UXpU]jouZL@yQYAv}1q]+Vwy2u-.̮{۪]n[etβ9ڥ}]طf[}ya"otGNErkg cK'66}R;|@vƴFq}2]7)0'T+ZPINSPbI:E}#b^Oɭlq+[.u5yJvQc}K~@R1/"F |q}R|D!Y iX)7/i8d P mBߠ?L9wH7uoW뀌 lqznN^xN/&Cx}0ud!* .9 w jȮbY:Wl-X> 2d\v"^;D 9Z&n&͟>_I⷇^IcGZLC;-#v:'i?.BJe1!khgѾ?pmX4X \stX*EKd)ܢulm6bo0j+/V3HwnD ihfلMDGm=OĆF,a #ۍ]X|(^K %#ش 0* 2PlAcP Q,4: !{%(@oj =qhޥԻA;B3;5oB=EG1zJWcbj09@o/rȠm8dӇt`YL(ZZVRZ%> endobj 36 0 obj <>stream HV TS $@&)MFHaj-vJ:kv:]UvnG}Y[mײm;9ugjMLnɹ}(a Yh+nl"+x5u0sGjp^ݿnqqsY ]?0ل vƩ~V0<5P&_GuX%__!?Նgav  |_ ؽX*7 j Y8ob9LKDR&i&:Jሤ%!V$Hex2!QNJNHMӦ22Yo0frrB^(q,U=ڇ]9s_~bϒƥ4-k|ˡ |]=+W{cmx6>MԷ޺<s^K/+C㟼q࡟>ςG:_'N:3>ιw;~GADbXG1d;% A".s/ٷ\ 9qa`` $Ɛn,op;9ހ!ʾDH!fd?'si\ 1v5kc];k8>_{=@=М;חGfϺ^pصɿMNLׅɳ&Onc2u hFӯ/> -¨]\½gVnUk'Xa5@t@V;vg: /1 3a 4%dw +s-/Rq  -ꂬ\`^Wzڻ"p kؼ6.6{#<"'EUQUp`dsuXmFPUkҔ,{xUZ"u]|c^h*T( U6Umήg.sa-XxڱYI:~78B;0"QYI!PEڊH&dy?crOW=^](C V"֝b'I_O8Q@FFQwt'UAvrbl`Ha:S!fShpM^csd3 G2-`c2,]*lԸ&E2׏9TMZKLy4JWN4 TzuȀ^pS):MjvdS$?KM):)ÞvNtns;h-Z)&d9r*WɌxY_[^%tw?69bړSy5ɓd͝3d AbS%ݦO/K68(.:=Xc< ޺5H8_5x;g;j4|9H pr j2 $EVh6*ԉn|T(R:Q☂4~)yV X#߈~k e"jX0'>T\ڱ<AU3DFQ<fN<xw5uV=SđQlϵ`3+3UMgΐ3iƊ8%_>(4sYFmJ$j LWb1dj ꦴLXQe%I,O* oa{{BA_X!T {`z9b:ZU+[[⾊ej(yR'Կ[cզrNSgN[s"*JTgqRˣEe2yS$jm*^+Ə8SI8q4NӴZ/M)*Pj@t@ꘐXK7Q KHclL@PQӦM&2O~߽7nCn>s>q:7VH2#V'd\Ɛ$mU̵"nO,$6.)#ETň^+)4C&?I!Tzk, 6!f}iG3>Bw1n)|_7Ov~/q~ɻ#qD;CN5h?i%5]*\&P# V*d`E96ګ5؉aCVB_zI3vwF]52`tW}[~~{{:wxLl}=N?Z_3SZr_p%` 2?{/Ev֮1'Jo RmW;;|y1qx~o_d_Vw a0~s59:8Up.Ovea)oC|HRu5m[#d"+܏> c73"u`F~1{2?r%U{cު.ac]fՌټBq@b'G7- `ZR %NA'*B\1١HrѶH#k %|Hk?zShN֩U^v~Nj*_,KN C\dMS'1[)L pX P!U+PG3;b8zfrD šNݟ訾G;K^<>$nEX Ad7@IddczVmWEe3H4ob!ITI}jUhMS~b|TwG +w}2 #E[|:,NGnǻ;P\9y/+;wiIvVgL/\3lJXFXoar_%,0m3XaݪUVAL^JǮ`S_WVo 0,W|#ȫg#wbnԫq1οG 8vFabݶl FCC[IC | C? jIQrsf?s™w?3ktOTS# [rf.ͻఫU.?ګᴋªKH} ӈYP2#068+;ņ@IfYܟp//pV!/@ Ph TRƻ/ZڣF`4ګ y"lgۮlQq?˘G vh t`{:зk`11IwFۅs-m]+emE8uPAP#;}I5Yː):L qndqˈHO=8o6=?fqF BI̗%ItiM\_ _>cko^_,XIαf)l;|cvBT컁g-dsuEW}-k^O>"ټ$7 ٥o3}dsw=OdI/5;S$=%_浖n OuJ>š2pv\[$}Ej%61L~GknǬ_.dOrv|}k?O9_Kݘc.ɟdx!z#M\eu#pҥf9œH@J0P%{ǏJOO+REJV4IRV|3+T~<8vrod$S8S2EǮN*bү3s>_|>}"ws2 3>:}o1F 5.LOR8=5vfli07rW. ֤YhSQ Պ3)=w06^ӠTv2=UZfݝC-24CoQ2TH|Dx=vHW IL4xɞBba&LmT$UzmCC29E6k!D΄8 )9I<tCx2r@P:Aw6vkЯ$T+薰)sP;65>stream H\j0@ -E-B0IYtfJjhd8}eЁ1$p{n$?ahnw]kh8SRo;܌Y;Re 7ꆃ{ߡs'?|/wv~kѹcL֌y {unO1ߍL\L;t26 ?lYįms pl?WzQȢN-5 mu^!Td)5$!UV$q8I"N &]+-%zZuU@Cơz zzyL02)rr* F #ZAWp7k w%,/q8h,q8h,-]k29,L|yƉ=i!Ikvcފ޻QĨ} 0> endstream endobj 37 0 obj <> endobj 38 0 obj <> endobj 39 0 obj <> endobj 40 0 obj <>stream H >Ro 8 endstream endobj 41 0 obj <>stream H\U T{A60B#KT(q `%Ȣl. Db3qH#Xh՘QhѶdѤ5Sm;c=o}wwK!1hbĠyss(ͪ)piv(\EGkҒˈ{ D&,Jx?u 1ԥ<# yG;ɦ$k*K ^P!v!L 0=5w߱|Oh;Tw>.."؂lD#,;/!Ifb seb1/b V3|kQjLEC0Uf`8(?5rfQn~}a |UlEc?#03PhRG,1KpBAa~R(Dpii,}Fk݌}8Ԇ#@Zم0)']Ɉi jqD-M{1]|%3-Ls4Whc\pHi V9>lq0S1X{'/:Gݶ_0oZFen3յK|ǬsFBR!->npa vI !ޠ"LFϸnw1,醵ی^/-ܫۂ0_l/vM7kW0B*KVit;Bunԍ_g?xj+3L6A5 ߠlRF^|%vwY=e '&m ޶/<lqb׹@ HFj &mp QR26V@+mO耎iՄPCE eݖ iLژEU@h{6M;{{{{WãfD,+h~ 8)A E>x!@Nǯ y 3,}ejLE޲=/dyXDuh)kC˖zGM\vJ欚a~&oDtޢTG!ZGIy{cVҾv)  I \RjB_^QJ4x(OjuR&w/_+-%rOKI0lZR(@-?Å W-i+\#މPڂ`_^UG5 \ΉBKF͹ԲLnɣvI0LwW(=wwb΀EQsq|bq{]ى$ZZT`@Qds-j !P"t񢎁ΖYB֘G,D¨8^ᣈ(TF  [=Sg]ba[$X}p2Rz(^y֝ xZr4dJtxkw0o'GnCi$1fLmoqJ,>uY8gwƥHʚƱq9UN׉$ nr@z x朵s̕n]uˣr3Qo8\/Jcc NV5vӋ| ߅OM-ݑK7_d;ٿWH%T!3tRcTMDeDnTf<'5p: 8:<N_CM4#C|d'M+>5ez40vWlAŲo0Dj aKl~&L  a3=nh.692PQV8j][e0] 'wz&`;];=v 9eTZ}KʖT<T:]+|ϗuVt6]=;}^~>x]/,b$ˏA*_紪S'9)qr'"DalSen4T1˄WM_ lAD 'rn&E6V Z$xQx"{^Xrtؘ<mw}{ClaϑMyi#I6Hmtѥ'KlwoeMv'MpvWu! `}w@C #4NQy8 }>Mh`nXN΁]96D  4U`̬5VR7#=;Jj^/ZN\\^kQ}wA 0uˍo!q<M fϴϔ}9ZݝJFFkޫWC7+]|,>OgUQC/+p#\)Q KzgIAOPEEQu僐6)c[I8m4d3[ְae*pa&>GZHSH-Np?wogՍH4kʪc PM`:;ؔ{ o~7m?~y%cǾ޴W?vӇw.{2wi{RPLȜJrU-L^0L(.UNz":,EƇ+`G291S>y@-wzs3!HG#t~6>oL8u)c}Hz<<__]O_ BW$@tM0.Ŝ♠^Nɔق0`,'xi7uo1b*]\c23Kܢ*ŦJ.& V1)|+gb0C*i/m$*U=2Gtć> h8,+.`C5 БhM5 P( %DĞzw\7ul_nwgyB+~z9Jm^ܼb۫'}kF~5'+bq{/:=C?]W)*]lYPC TLfF|b\+qj:SS k. <߶{"Z gE hh (i; Uu,/XU߮_-Yj>X -*)} +"!R愜2zW'T./YRyL֝Z RUЕЕЕ9Cp4"ϧE `L\Pq&aZUY-rV4ΊCA$u޾_%culs?+cnD '/:Џgy!{1wBgO +ˇ^R@L=>U7JQuLKDF(eQG10AG@(:v@/%zr\2HYYgHjq8. KjTA ^a#U1h4/6XbDK^n=ݏl]=gwdORw楝?gdz?yc4`ߛW*15H2:c&mlH+FfF-a" t<&n,Es򇘡 RYSve?+:R ը.*nn2P39D2^G"e⚦b| C9EQE(x Mf)MGpl~[ U٥GU 0aWE_AW\ 35`3$Y7NL; 3m0yhYAZ[N@릏p;0\ ħLrFaoS9+Pιs\%J-.xGe1*bD&bK*DA#6wJ*Ԋ6K"ŀCUlH8˳!"%21wBTE~n3M0[=FX9Y;?+r س}Hovd wϲҧ5wڟ~W}qM 2פ0 ơjR8Z_M=a|i}'Ȃ#ZSJf/l!ACqz̤lGMx O94&` _ǕJ")Co d] D: ,:@$rf9W"_˻-DV0(b@.CF-|QJ|Ϸbc'Krqp (  pY΂i:ZBi..n[ y[< jm!`Di1`V y' ӣ@+A@¯wJC ! sgs7]kl67GUbq4l UN#[cέ^a2Mei7[,'$d\gCgY?qY}ڇ&{z<_6OL z5D4x}*W:BO64"3YO^~ kU0c.xcjcnYV Q`1ɢ 6jeAedEHY$,n {g![/T>?xjMLwz/_~6j1]2ȖA ʠmwe+:u7z=.ZV:)ڍ.ˑ@蠹/7{?GC/e^_ ZQ7|:grI%@rא7 ϧFR4,ɊQYXW<55 Ex"4|6c誘A5%$fLQ|ENE+Ks7o~ۇs_ '~H._}eӪl}g~:d|;6?ں~噯`ﳟ`e)ЅAdʵp$F|!{ & , oaV>l:Nx:v hj%`ҿ-`,zvӵDL&aQdP͏t7/M&,lI[mFeTnhjTіz5qV!88dWbDEJEnK4 *#sBLQ^ԭ/l)WŽ+ҥ`tFaԺ!`vR3;0wT N?`g@<3r I"xGf=impw':p)U)4iK+{Ey;soC0焆n!Cly3}ObQXh`זsb(16Uc,;szOx<$ |ܡt+VlJ/0.w Y,orN]Nc'QR[q|A(hպ*\W$vXAnjbTe[ʫj\EČ0/6Gu2 @)<(DWMNLS[BFTdR[ ڶ)SxG4F+qY@T4㓩ƱTA^*@'NVQpk* [YXmEc ^[b5U$\US "4;kv Q@_9 k /^U4D%* m~en6(I7WFґ}]Ks=wnS5D$_5J]h(T%TIE@gK|SrX1 0"\vyx핬𡫧U $ ୋ /+,(>yqvcI@ZKr@$Ea8A5cK UޡH*rD O`:caQwCA \>[j?=8}U"ejiy2c2]s< Kegyа199lBX{":\ :|ZM8wwiTmخ&+]iW^:vڋ,r倨W@!A$! Md  Id (8P: L -r %{OLmiV{}$Cm.@bYX+QKi9&.ƭ^| i{0C1~`WEw!F*+ʔhhXʉ1S".l~MP-G D1 m@[.d?B]k^}JDX;"KdʑP55+ka|O|quXR"%MC+VfB6Kۥ~ɹ]jJ8I+8rH,m :B %ٽFa4Mtflgy+*s Vvx)-t@=j n`hpꢸ(<41-LL Uc.TT7j- NV:SIu,T/ $P&P&P%1dյ֏NΗJycbBSSF i&rO엉'GuαNgb-Ĭ5Gˬ-?"ґIڤHƕ"g9 y$i}ֻoKƷ~Lȉ`^&w<txB o8)/Qٻl;5nؤ&|cO{_DOR.j-p`? !=T!8 Wʲڸd?F'SGE@B@8AD=tj< <E㇡7{mFBM>V#})tmLk`V )2z. )j(#;vV_.b3~r+Vs~yO];ग़/r)F3z52 q+VIJkd"{41qM6^"$L >H@lhWf(we ѧ́f}{Gܥ\iar-eZqCG}>ͷ-I%OK52'X5j`.0ר#e/s&]z2"G%rIM8 KQoܢÙP$ũQبbEb#"lAA0 !B](zR P/ LۚdW8>i9'L[ h(zFdJfj*dz  0oŨI? 1Q«owpj7t]?o%Yw$ij+X߿8W(猣XrJ9瘽:R1)>.:u=ӂsygfuy&p 6z[4ˊG"N6*Fub;Vh>){iw I!!N*22tHVN-zVT'< 2ARjVͱJPqO<\ER^*A(5\`7c#G4~D?*(XmN _ 1E"{BQ3($b(J6=4 ,L+l<ݓ#4SMk2M 6:rȠC>k͙-_m~;q0;hߊ6;X8=yL:(ӄ(:޵u1CT-g ʻD~,ݭYwlmjYnk_7֝Y?Z5kwԌyKjKnlq7ovdGv9'=㗵 jvr%5ʄrH'GҒ3;ZҦWͤA`aG:kOl_`c3V-1jjMjlt'e}9*eJ2%S|ܱLsKr+Aiz:G5k\u9Gܜ#n5Uk#=W>-ӡ5g34Q4T ,8aA }ϏDqɏfQW7XeGߙ'^hgw祟?…oY<}wf빻3mz7j+v˞zM񠤊~] "_۟T~I;3%עeNsL2H6!G ׋02] DJRSq:>4H9!̫GIOxތ=եPR O5 oAW8<5Ol[>Lq6J(.[nCC[zznTc=@/<Y#̊teR PDuêݱ5Sq(lxb/UOדk^Zuoӿvx 7؋Qjk4  PД *pt"c'nZd4,.W#=x+9"G<&'Ȳ(ʝrFe &v})BF+|'|bOrUm\q[=wnSsjon*S*$2j9ԟo?T1oqUC\T*4kBl栚`ةTF^{`^|TSeq@C!u02eWZ[ GZ{aXM{{AVCTpkkŲp::fx4M{*L*nG55S֬&/f Hwb]}Cbd2"993vh`gZ!QX.Ns}Q<_ ;BdN/;c:_ äV}FWLU[ %j9Ey;6LB*;g>;NVBM5i:fH(Gs:1Me #K:@tyM)4(N%'$w[PJ@sZ2 & B$;8 h?!ڦAjST[E6iKZDD6lG87gs8 P:f, b $QL'#2‰H[] J Qb%ڠtama"R2qɥRj<2EПU*!;ݍ(jYAӈZ?CyiM%t8S2>es2ڳI5Kw\&R`O0$6D:BvJ,)&)h!h<XYv-}'/Z?\|ռ󩁵 et7^ Oc[zn(<'*(/&'; 3x0𶔛u<(j&ɦIf B. HE-ii낖FIZ"- aPkSH[ [V uu0`4xEƣ({<⻩qlji"9̒ӼnQby>Skf X`&=$f*{ɩO5'iLԄl|#aoCIIj۟zuVtW7X8<}{'ߚ~]Vn$g&v`o1^:IC"u;ľ؎m %ƥ0( e%8 1B@6BlB- JJZ[i&@c?(L˪,BJ}B'Y_ݽ~vBd?l*iJzV蒤h "}~.jGC_qjOG_ފˈvpW+\Ny"弨Q 9 NJE(H--Fa*WBX#P)0e3EDUD(u%3icp1h|)(  >?["H_!6{gE\Yl c/5BdHs#<T)PYH  u  Nwog^c>[R¬La0Spx R:+*J!،61u(bd}M\+OK:ޠzYNg4הl>}7zg{Z綽nc] /-[v`c_~yKn^/RJB뮡/g$ |?/M"5E. {XL%,% r ePcX5VoS'MQB;T4"t+K_mR;Fh eMzY^ "$K|]-<>wckB1>vw3-kFD24LUHö9l4٘uPqT9A NpJ'`?Od!ZL ɞ;k#6f.rOsZpI*\򔔒[&r[3L:IMkH˫<ԮQMH_<)F99=ֳL8A RN0_قlJp)5K*E#VVD~ǽWL5Pb.5`fy!3/PQ<0N9*0*!=|ZRŦ Lap d0嵞xGRf1 3lpMhZpi] 2u:H!@@LU+oQp5H)<p? f)ȇ[Ae:bRS1)-,ûe'c a;bh,B+g,gk[0% K~)5sȜbDwաd ؛[<<S [{M3.2~3l?SL%ݡԠ^+HVbt:Bg/EWQYQW+TYݻ}T!'/`nc& F8g^)dPd8[8-gV:z卥O|նڵSʖݺ>#캲9:I꾷{IxngKA9UĎR[55v ?6N 8 0OPF]&FX؅t2Lǯ&P{1ٖ1|2Y%yD1xQ! "h#аhk#  Tmm[RK#a]٦QFapzTr6l`uhd6ؙ٣AԴz*u62 邖,kZ*ȩfTgs点l;s?R* SRL )XKx)RBdX72$k!,1Ý,=|_{b*ԫe-0Gx{9A-W+iQ JunjU蝕V gF]-;n9T z/[v7,-lᎌ}eV벶ChE#?VT#iw !mGT%:; i{r3E-!Y #7ܘs)*Cn%&$ͫ5%8ҳO|-XeeL&ITNVg$3zd!2 DYi.˖&ƲHõ4#jt_>}O /@wV2mvЙ~%m,l6P=8B&ʦ+)g|y !3LKft#f C)!e-TsEUI)X(6P䖳 J%R?oW@XMT~ U(xA,F*4ODa=Ayu!]ꫧo aO$E0Pu]5-_4zmW(> b=8UpTLxL.eF܋ QBdVʏt~dg˼5ޏ= #Q"3Alt嵘cTm(Uz/GHD1t|D@MhqܞKZn$ 퇥GP]KGe)ߧWwkʐ_Sn)KUkZ.XDkQz3~c~e$rI>w'zPM!]!m%P؎sۉTZum,cmUYm L_ 0'XEj pëioE)uyoxX<2uVTTuIo/,CbPes ܙL| KÍܱT-z@Uιڲ˲5q\ q" aT#㙶%^χ\xΛ=͓$A`+]VvϐAf`G"-VY}B@h VSC[" .D;;xשׂzR`uUP *0Q Y,#!1Þ-f-!ZBZye@ [ `r G}4  7&Xb9`0`+B}g]*8GV46Szœ6 ws67vB% 1wr(GbX>` "^X!l VseO'8ݣM^Ք:WЫH ;`{T@=wc%^lLm;{%]UwjCsV6Nm:Ʒ8T~еmIv)`mq?#~I#~Сpt汔^fh/Gz`+V,{V{^?@wkWo$j5t3گTu!-q8d‹?C}:gՔ3 ର rv7XEJIۜ PYVB bTU/lJ^oeAZM)!l'D"1&\,~| y;3v'sP@1ԑ_xx еϥ ,Gk4Fg-at ZM)n;;hV6}F(\3V©xqʊ33װ*s*TQuaCeQjת6=O)o=s@O~6KT )I #/;T8;A&Sm\poqQԶÛ;|}۝ǵ'uN5-x==M.Lp?>M}pq%7znw:̶2y&A[Jv=҅M*'a}"> ? КVV[mvý,]d/ج;{ϽO/-nQ@Q` 68X|ŶKqAY9i*bmb keffese$nn#Ek{p 2Ϟ;91^ʃ>k:f6sP6sd)ƽhD>i7K~m"V/f\^?3 cOTYw6wo3g)XW/uNOtm|\<qk?=|8 LS-.xHt-=`t\98˙3t68pWIz;$s3T \mu*-ziq|{odULp&e9U+@3sC\sJ X K Mazz9}>тM\gv K}8׿+3t0m\)-Z{f6}`^'gnfS{hp.]gECL9_fe[4L־ݿT`|t˥Al+b;tVhaXÎkfU\!Mk9+ڈ[ds^HLisߗ?؝*ӽ<}:rMn).D~2MdWVo7l/;!>=lr6?ʔ y^gNcyr.ls =SX_84D6g3vqxT~}fRt|;}0]`= 6(((z4gl9,Oyw3_'k,3w!r͉ZYsQԺoR/iETFNU6Bn7eRwP}3S2r]2>2~- d [MAY$o$6{}tV;HFO-6g~\cny+ |5Y#_lbgW0nk:TOkA~'3jӼΰؤblYQX+sZhk<|wLJq[X{:Pk_E2گuXNa}]iuK;JZaIkxXmNqb-v@^gD͡?3+[\ݙHf~~(OYļ*OFe3Z[vjKmMvu&4s_/%r 07s׌N&10HJZ-Ϯ=Pfǥ!]r]t<~v:/㴏yJrN)ivQ^.Il :81fVA0̒?x>%S͒7 2[f~}Kstxゎ8t(9٬7\t(R\rI;3qJt4K;Ǣ=F3@OPs v~o}_rS6$&~v4yFDl{3%;/ȒtDv0`<)?{do/!P)_rשNLV8u1h_;Tp^g%sK}'_'spi>x[K'yǛ Ϋ^+!*B.VX Cеi#{O$m߄]w8fu~[kS{7[/@>D%]ȷE ΅(7*,7x~0kD?{[b0΁7}[>ƉO) )O:ZkYm}:uEr"FL_v|S^[¼[Gdq!WCgrؓ}6ڠ@>F"׽H"D9-b9󖇛#O X#\2E<Cy<!s+EA"^s+a˱$=n{Q=3V wÅ-̎OjH[(sF80%̡m t@ mYǒ#U ~& |!9}ʞv93Se2]pȺ5Ab5 {9,O'I1L2%'(3b)7Wsێb,ɑ]loҜ)U2?c4]/O>*sNX/*3?=G[V+.m-]atC`Rڕ\*lNshl P f)$Dbf#-Rz9罽}f<1 yU_taAM7!.߯_/??m7a^ kd5&Ư*q5Uk;8s{`NYX.M= >+\tΫ{#>GPޢ,"q28_Y`)o]3hC35z=RUo[c\ը OwB:JڤzY؇hJScCDXGw= |>g?5jƪzixH"$ưºa*&b__7{W}M'ŗcaBd J. S-H\cZMw}yȰB7S`7)6hO('ֳ;LMcA?Fܿsag= w+wA]7A>1A6Ƒ\q$/0DA~^/Sq$Z eӃ zpOxFmNx_jĔ{l/ lϓ P_`($;GփJuGu g:컁wYݟ}olfWk}C=ZY>:HQ{)OQ?4-߁;f\cփ| tq/b@A[Q|]bC*'R  Y7wbA@+(9۔圡r$AOEst~5Hw2a ֤TFhx_fjB}ow#Σ:i5_aTx.Tme|ؤh}%@}HeX;}e{4g 45f:̶ ǠT$3㧽lȹ=y^7Smr&p`.tj! T=@:5TTb OcgRoۛ9se;N{ҋFT+f6hp&FubQ{\,jݑ_jgP͚1ye7zkROj)pƺS &S&3Snhh *eߥ掯D`|8_Mul3?%OutCYeX>רwȐx]mL׫Sܧ D0HzLz]짡>}uACViC}k6~ӱV ;__ecҤol%+i4!4oM~ZuFDz~/źow@;}g+UBHxKbt~BߠH "/1*#BD%[_4BhyIu9 T]4l_G]0ؘMv\y6xp'ߺL(.i?lź]ƽXt;Omʘ4Eƅ2=邆>"}zvh3G*w2ک|AoA{~'dM I;+zO欆OJ묅kŰCk?{;:#62om6؇5s:s\_cź@YJ,%?P+3V] JOjR.ebo.v% &Rt1W_}_r6Wm8i5"3e_V`9[EK4BTS!N w&l^Vߎsr偰~֡(1iP"!@GО.תh\0C9 /%E!2̷7^3 ~2ο8tQ69eS}}-T3Eab(AV/;cXYm 7>%L(̥^#dI7h% W"[/#탬S(s\"܅c9}*6]~RBi淋y?ؗ^2ڲ1`/]h4:ϥ $wl{wwΪJ g ҩ9qT=&jP]`R3p:yA NS}ǡ f>9{o9A4NBP޷>gN 7[ :s]w U@]^Ve)/|](AՉ3יI"N:c;-Nә^] thlBMij$C!A?n$Nvg~?﹇s}uy\+k.C$w uR_S?.m`n n+& @˛U nLRD7O]%rWcDeabsst[ceYڢD~w*Q1[-6l! Ogզ%Du}߅MXD=M#!H$D"H$D"H$D"H$D"H$D"H$D"ÈR#tӏATBmD/xNF@THvQhmG[MZ4ƒJj;tvR;d1&HjF^v!9דZAߗvIz4 R)hJ=En5[6-b{MG1zԇQ3vA0kQ( CX5=]`Gi7bȗ ZLkj =F؞b-ק5К}ⶶMmu-poW_Cjfz.m;hWn-￸m(@PகnY{'}5r~پVe?K|^YAӀ++luLYdש7Yth+J̨!i0lԩF<tpgj Qo\SebwKɤ0 RK@#C`Mh`0{BJfٕ{f)3 .YV Zfe[kVYV^VdeOAPy~jp"d"2rᱣIe+dKH㊍N(, |5VJf5HXt*qh| ㈗Y Z>sG z`,\'q$.$ l@Fd@'3`ćB,U3nNgp%xڜXIrҍ'QrQrxN(uuʐ|7唑OO3=RG?ITJ |q!%Pv`?ϩEaױ5g4`W)*|{p+/Rϲ4qԨz7oC=YKX\Z^UQ_+I8rޟ`Hg5:P_2q">.Ҩ^#jul@-R[:Wݮ0Zݪ\1j)d!&k4g 9;AG#ǡ:K ۙ9tڝ6'wsabv: \vHv6SR<d|E-լޘA5㖼c^^53BHeZvZ8Omduw={1neOT3PZ+`M!u𥠴c譴 +#XE€g+$$7Oxz2t.倩jp[*;ĦSW]*x?ɝK)|%2 |-򴅽~X2Jl!Rye%D,J#aB2 #VR#vjP endstream endobj 8 0 obj <> endobj 9 0 obj <> endobj 5 0 obj <>stream ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx